### Start JBrowse 2 Developer Instance

Source: https://jbrowse.org/jb2/docs/faq

Clone the JBrowse components repository, install dependencies, and start a development instance of jbrowse-web. You can specify a different port using the PORT environment variable.

```bash
git clone https://github.com/GMOD/jbrowse-components  

cd jbrowse-components  

yarn  

cd products/jbrowse-web  

yarn start  
```

```bash
PORT=8080 yarn start
```

--------------------------------

### Create JBrowse Installation from URL

Source: https://jbrowse.org/jb2/docs/cli

Downloads and installs JBrowse 2 from a direct URL to a release zip file.

```bash
# Download latest release from a specific URL  
$ jbrowse create /path/to/new/installation --url url.com/directjbrowselink.zip  
```

--------------------------------

### Setup JBrowse 2 Development Environment

Source: https://jbrowse.org/jb2/docs/developer_guides/simple_plugin

Run the setup command to download the latest JBrowse 2 release into your project's .jbrowse directory.

```bash
yarn setup
```

--------------------------------

### Run JBrowse Development Server Output

Source: https://jbrowse.org/jb2/docs/developer_guides/simple_plugin

Example output from the 'yarn browse' command, showing the JBrowse development server starting.

```bash
yarn run v1.22.10

$ npm-run-all jbrowse:*

$ shx cp jbrowse_config.json .jbrowse/config.json

$ cross-var serve --listen $npm_package_config_browse_port .jbrowse
```

--------------------------------

### Install Project Dependencies

Source: https://jbrowse.org/jb2/docs/developer_guides/simple_plugin

Install the necessary project dependencies using yarn or npm.

```bash
yarn # or npm i
```

--------------------------------

### Installation

Source: https://jbrowse.org/jb2/docs/cli

Instructions for installing the JBrowse CLI globally using npm or for one-off executions using npx.

```APIDOC
## Installation

The command line tools can be installed globally using `npm` as follows:

```bash
$ npm install -g @jbrowse/cli
```

A CLI tool called `jbrowse` should then be available in the path. You can test your installation with:

```bash
$ jbrowse --version
```

It is also possible to do one-off executions using npx, e.g.:

```bash
npx @jbrowse/cli create myfolder
```

It is likely preferable in most cases to install the tools globally with `npm install @jbrowse/cli -g` however.
```

--------------------------------

### Start the JBrowse 2 admin-server

Source: https://jbrowse.org/jb2/docs/quickstart_adminserver

Run this command in your JBrowse 2 directory to start the admin server for temporary configuration.

```bash
jbrowse admin-server
```

--------------------------------

### Start Plugin Development Server

Source: https://jbrowse.org/jb2/docs/developer_guides/simple_plugin

Navigate to your plugin project directory and run 'yarn start' to launch your plugin's development server. Ensure JBrowse is also running.

```bash
cd jbrowse-plugin-my-project
yarn start
```

--------------------------------

### Example SyntenyTrack Configuration

Source: https://jbrowse.org/jb2/docs/config_guides/synteny_track

A complete configuration for a SyntenyTrack using the PAFAdapter. This example shows how to specify the track type, ID, assembly names, and the location of the PAF file.

```json
{
  "type": "SyntenyTrack",
  "trackId": "dotplot_track",
  "assemblyNames": ["YJM1447", "R64"],
  "name": "dotplot",
  "adapter": {
    "type": "PAFAdapter",
    "pafLocation": {
      "uri": "https://s3.amazonaws.com/jbrowse.org/genomes/yeast/YJM1447_vs_R64.paf"
    },
    "assemblyNames": ["YJM1447", "R64"]
  }
}
```

--------------------------------

### Start JBrowse Admin Server

Source: https://jbrowse.org/jb2/docs/cli

Initiates a lightweight admin server for managing JBrowse configurations. You can specify the port and the root directory for the JBrowse installation.

```bash
jbrowse admin-server
```

```bash
jbrowse admin-server -p 8888
```

--------------------------------

### Starting a Local Web Server with npx serve

Source: https://jbrowse.org/jb2/docs/tutorials/embed_linear_genome_view

Command to start a local web server from your terminal. This is necessary to view the HTML file with embedded JBrowse correctly, as direct file opening in a browser may not work.

```bash
npx serve
```

--------------------------------

### Create JBrowse Installation in Specific Path

Source: https://jbrowse.org/jb2/docs/cli

Downloads and installs the latest JBrowse 2 release into a specified local directory.

```bash
# Download latest release from github, and put in specific path  
$ jbrowse create /path/to/new/installation  
```

--------------------------------

### PAFAdapter - Minimal Configuration

Source: https://jbrowse.org/jb2/docs/config/pafadapter

This example shows the minimal configuration required for the PAFAdapter, specifying the file URI and assembly names.

```APIDOC
## PAFAdapter - Pre-processor / simplified config

preprocessor to allow minimal config:

```json
{
  "type": "PAFAdapter",
  "uri": "file.paf.gz",
  "queryAssembly": "hg19",
  "targetAssembly": "hg38"
}
```
```

--------------------------------

### Create JBrowse Installation from Specific Tag

Source: https://jbrowse.org/jb2/docs/cli

Downloads and installs a specific version of JBrowse 2 identified by a tag.

```bash
# Download a specific tag from github  
$ jbrowse create /path/to/new/installation --tag v1.0.0  
```

--------------------------------

### LinearReadCloudDisplay Example

Source: https://jbrowse.org/jb2/docs/urlparams

This example demonstrates using `LinearReadCloudDisplay` for a specific track by providing its `trackId` and `displaySnapshot` configuration within the session JSON.

```url
https://jbrowse.org/code/jb2/main/?config=test_data/volvox/config.json&session={"views":[{"assembly":"volvox","loc":"ctgA:1-10000","type":"LinearGenomeView","tracks":[{"trackId":"volvox_sv_cram","displaySnapshot":{"type":"LinearReadCloudDisplay"}}]}]}
```

--------------------------------

### VcfTabixAdapter - Minimal Configuration

Source: https://jbrowse.org/jb2/docs/config/vcftabixadapter

Use this pre-processor configuration for a simplified setup, assuming the VCF.gz file has a corresponding .tbi index.

```json
{
  "type": "VcfTabixAdapter",
  "uri": "yourfile.vcf.gz"
}
```

--------------------------------

### ChainAdapter - Pre-processor / simplified config

Source: https://jbrowse.org/jb2/docs/config/chainadapter

This example shows a minimal configuration for the ChainAdapter, defining the adapter type, URI for the chain file, and the query and target assemblies.

```APIDOC
## ChainAdapter - Pre-processor / simplified config

### Description
Preprocessor to allow minimal config.

### Configuration Example
```json
{
  "type": "ChainAdapter",
  "uri": "yourfile.chain.gz",
  "queryAssembly": "hg19",
  "targetAssembly": "hg38"
}
```
```

--------------------------------

### BgzipFastaAdapter - Minimal Configuration

Source: https://jbrowse.org/jb2/docs/config/bgzipfastaadapter

This configuration allows for minimal setup by specifying only the 'type' and 'uri' for the FASTA file. It assumes that the corresponding .fai and .gzi index files are available.

```APIDOC
## BgzipFastaAdapter - Pre-processor / simplified config

preprocessor to allow minimal config, assumes yourfile.fa.fai and yourfile.fa.gzi:

```json
{
  "type": "BgzipFastaAdapter",
  "uri": "yourfile.fa"
}
```
```

--------------------------------

### BgzipFastaAdapter - Minimal Configuration

Source: https://jbrowse.org/jb2/docs/config/bgzipfastaadapter

Use this configuration for a minimal setup, assuming your FASTA file is gzipped and indexed (e.g., yourfile.fa.gz and yourfile.fa.gzi).

```json
{
  "type": "BgzipFastaAdapter",
  "uri": "yourfile.fa"
}
```

--------------------------------

### Example hg19 Genome Assembly Configuration

Source: https://jbrowse.org/jb2/docs/config_guides/assemblies

A complete config.json example demonstrating how to load the hg19 genome assembly. It includes details for the sequence track and reference name aliases.

```json
{
  "assemblies": [
    {
      "name": "hg19",
      "aliases": ["GRCh37"],
      "sequence": {
        "type": "ReferenceSequenceTrack",
        "trackId": "refseq_track",
        "adapter": {
          "type": "BgzipFastaAdapter",
          "fastaLocation": {
            "uri": "https://jbrowse.org/genomes/hg19/fasta/hg19.fa.gz",
            "locationType": "UriLocation"
          },
          "faiLocation": {
            "uri": "https://jbrowse.org/genomes/hg19/fasta/hg19.fa.gz.fai",
            "locationType": "UriLocation"
          },
          "gziLocation": {
            "uri": "https://jbrowse.org/genomes/hg19/fasta/hg19.fa.gz.gzi",
            "locationType": "UriLocation"
          }
        },
        "rendering": {
          "type": "DivSequenceRenderer"
        }
      },
      "refNameAliases": {
        "adapter": {
          "type": "RefNameAliasAdapter",
          "location": {
            "uri": "https://s3.amazonaws.com/jbrowse.org/genomes/hg19/hg19_aliases.txt",
            "locationType": "UriLocation"
          }
        }
      }
    }
  ]
}
```

--------------------------------

### Verify JBrowse CLI Installation

Source: https://jbrowse.org/jb2/docs/cli

Tests the global installation of the JBrowse CLI by checking its version.

```bash
$ jbrowse --version  
```

--------------------------------

### BamAdapter Configuration Example

Source: https://jbrowse.org/jb2/docs/config_guides/alignments_track

Configuration for the BamAdapter, used to read BAM files. Requires the location of the BAM file and its corresponding BAI index.

```json
{
  "type": "BamAdapter",
  "bamLocation": {
    "uri": "http://yourhost/file.bam"
  },
  "index": {
    "location": {
      "uri": "http://yourhost/file.bam.bai"
    }
  }
}
```

--------------------------------

### BigBedAdapter - Basic Configuration

Source: https://jbrowse.org/jb2/docs/config/bigbedadapter

Use this configuration for a minimal setup of the BigBedAdapter, specifying the adapter type and the BigBed file location.

```json
{
  "type": "BigBedAdapter",
  "uri": "yourfile.bigBed"
}
```

--------------------------------

### Example QuantitativeTrack Configuration

Source: https://jbrowse.org/jb2/docs/config_guides/quantitative_track

This is a basic configuration for a QuantitativeTrack using a BigWig adapter. Specify trackId, name, assemblyNames, and the adapter details.

```json
{
  "trackId": "my_wiggle_track",
  "name": "My Wiggle Track",
  "assemblyNames": ["hg19"],
  "type": "QuantitativeTrack",
  "adapter": {
    "type": "BigWig",
    "bigWigLocation": {
      "uri": "http://yourhost/file.bw",
      "locationType": "UriLocation"
    }
  }
}
```

--------------------------------

### Run JBrowse Instance

Source: https://jbrowse.org/jb2/docs/developer_guides/simple_plugin

Start a local JBrowse development server to view your instance. This command serves the JBrowse application from the .jbrowse directory.

```bash
yarn browse
```

--------------------------------

### DeltaAdapter Configuration Example

Source: https://jbrowse.org/jb2/docs/config/deltaadapter

A basic configuration object for the DeltaAdapter, specifying the type, URI of the delta file, and the query and target assemblies.

```APIDOC
## DeltaAdapter Configuration Example

### Description
This is an example of a minimal configuration for the DeltaAdapter.

### Configuration
```json
{
  "type": "DeltaAdapter",
  "uri": "yourfile.delta.gz",
  "queryAssembly": "hg19",
  "targetAssembly": "hg38"
}
```
```

--------------------------------

### Example Session JSON

Source: https://jbrowse.org/jb2/docs/config_guides/default_session

This is an example of a session JSON structure that can be exported from JBrowse. It defines the views, displayed regions, and their states.

```json
{
  "session": {
    "id": "eXr4hv4VX",
    "name": "Session",
    "views": [
      {
        "id": "eXr4hv4VX-view",
        "type": "LinearGenomeView",
        "offsetPx": 14500,
        "bpPerPx": 1.7,
        "displayedRegions": [
          {
            "refName": "ctgA",
            "start": 0,
            "end": 50001,
            "reversed": false,
            "assemblyName": "volvox"
          }
        ]
      }
    ]
  }
}
```

--------------------------------

### DeltaAdapter Basic Configuration

Source: https://jbrowse.org/jb2/docs/config/deltaadapter

Use this configuration for a minimal setup of the DeltaAdapter, specifying the delta file URI and the query and target assemblies.

```json
{
  "type": "DeltaAdapter",
  "uri": "yourfile.delta.gz",
  "queryAssembly": "hg19",
  "targetAssembly": "hg38"
}
```

--------------------------------

### ChromSizesAdapter Minimal Configuration

Source: https://jbrowse.org/jb2/docs/config/chromsizesadapter

Use this configuration for a simplified setup where the chrom.sizes file is specified directly.

```json
{
  "type": "ChromSizesAdapter",
  "uri": "yourfile.chrom.sizes"
}
```

--------------------------------

### Run JBrowse CLI with npx

Source: https://jbrowse.org/jb2/docs/quickstart_web

Executes the JBrowse CLI without a global installation using `npx`. This is useful if you prefer not to install packages globally.

```bash
npx @jbrowse/cli --version
```

--------------------------------

### Install JBrowse CLI Globally

Source: https://jbrowse.org/jb2/docs/cli

Installs the JBrowse CLI globally using npm, making the 'jbrowse' command available in your system's PATH.

```bash
$ npm install -g @jbrowse/cli  
```

--------------------------------

### CramAdapter Simplified Configuration

Source: https://jbrowse.org/jb2/docs/config/cramadapter

Use this pre-processor configuration for minimal setup when your CRAM file has a corresponding CRAI index file with the same base name.

```json
{
  "type": "CramAdapter",
  "uri": "yourfile.cram"
}
```

--------------------------------

### Execute JBrowse CLI with npx

Source: https://jbrowse.org/jb2/docs/cli

Demonstrates how to run JBrowse CLI commands one-off using npx without global installation.

```bash
npx @jbrowse/cli create myfolder  
```

--------------------------------

### Example BigWig Adapter Configuration

Source: https://jbrowse.org/jb2/docs/config_guides/quantitative_track

Configuration for a BigWig adapter, specifying the type and the location of the BigWig file via URI.

```json
{
  "type": "BigWig",
  "bigWigLocation": {
    "uri": "http://yourhost/file.bw",
    "locationType": "UriLocation"
  }
}
```

--------------------------------

### UnindexedFastaAdapter - Simplified Configuration

Source: https://jbrowse.org/jb2/docs/config/unindexedfastaadapter

This is a simplified configuration example for the UnindexedFastaAdapter, requiring only the adapter type and the FASTA file URI.

```APIDOC
## UnindexedFastaAdapter - Simplified Configuration

This configuration allows for minimal setup by specifying only the adapter type and the FASTA file URI.

### Configuration Example

```json
{
  "type": "UnindexedFastaAdapter",
  "uri": "yourfile.fa"
}
```
```

--------------------------------

### ChainAdapter Minimal Configuration

Source: https://jbrowse.org/jb2/docs/config/chainadapter

Use this configuration for a basic ChainAdapter setup, specifying the chain file URI and the query and target assemblies.

```json
{
  "type": "ChainAdapter",
  "uri": "yourfile.chain.gz",
  "queryAssembly": "hg19",
  "targetAssembly": "hg38"
}
```

--------------------------------

### MashMapAdapter - Pre-processor / simplified config

Source: https://jbrowse.org/jb2/docs/config/mashmapadapter

This section shows a simplified configuration for the MashMapAdapter, suitable for minimal setup.

```APIDOC
## MashMapAdapter - Pre-processor / simplified config

### Description
Pre-processor to allow minimal config.

### Configuration Example
```json
{
  "type": "MashMapAdapter",
  "uri": "file.out",
  "queryAssembly": "hg19",
  "targetAssembly": "hg38"
}
```
```

--------------------------------

### BedAdapter Slot: colStart

Source: https://jbrowse.org/jb2/docs/config/bedadapter

Specifies the column number to use for the 'start' attribute. Defaults to column 1.

```json
colStart: {
      type: 'number',
      description: 'The column to use as a "start" attribute',
      defaultValue: 1,
    }
```

--------------------------------

### IndexedFastaAdapter - Minimal Configuration

Source: https://jbrowse.org/jb2/docs/config/indexedfastaadapter

Use this minimal configuration for IndexedFastaAdapter when an index file (e.g., yourfile.fa.fai) is present alongside the FASTA file. This acts as a pre-processor for simplified setup.

```json
{
  "type": "IndexedFastaAdapter",
  "uri": "yourfile.fa"
}
```

--------------------------------

### MCScanAnchorsAdapter - Simplified Configuration

Source: https://jbrowse.org/jb2/docs/config/mcscananchorsadapter

Use this simplified configuration for the MCScanAnchorsAdapter when providing minimal setup details.

```json
{
  "type": "MCScanAnchorsAdapter",
  "uri": "file.anchors",
  "bed1": "bed1.bed",
  "bed2": "bed2.bed",
  "assemblyNames": ["hg19", "hg38"]
}
```

--------------------------------

### LinearGenomeView Action: setVolatileGuides

Source: https://jbrowse.org/jb2/docs/models/lineargenomeview

Sets temporary vertical guides, for example, for LD display hover effects.

```typescript
// type signature  

setVolatileGuides: (guides: VolatileGuide[]) => void
```

--------------------------------

### UnindexedFastaAdapter - Basic Configuration

Source: https://jbrowse.org/jb2/docs/config/unindexedfastaadapter

Use this configuration for a minimal setup of the UnindexedFastaAdapter, specifying the adapter type and the FASTA file URI.

```json
{
  "type": "UnindexedFastaAdapter",
  "uri": "yourfile.fa"
}
```

--------------------------------

### Example Hi-C Track Configuration

Source: https://jbrowse.org/jb2/docs/config_guides/hic_track

This is a basic configuration for a Hi-C track, specifying its type, ID, name, assembly, and adapter details.

```json
{
  "type": "HicTrack",
  "trackId": "hic",
  "name": "Hic Track",
  "assemblyNames": ["hg19"],
  "adapter": {
    "type": "HicAdapter",
    "hicLocation": {
      "uri": "https://s3.amazonaws.com/igv.broadinstitute.org/data/hic/intra_nofrag_30.hic",
      "locationType": "UriLocation"
    }
  }
}
```

--------------------------------

### BedGraphAdapter - Minimal Configuration

Source: https://jbrowse.org/jb2/docs/config/bedgraphadapter

Use this simplified configuration for basic BedGraphAdapter setup. Specify the adapter type and the URI of your BEDGraph file.

```json
{
  "type": "BedGraphAdapter",
  "uri": "yourfile.bed"
}
```

--------------------------------

### JEXL Feature Operations: get

Source: https://jbrowse.org/jb2/docs/config_guides/jexl

Demonstrates JEXL functions for retrieving common properties from a feature object, such as start coordinate, end coordinate, reference sequence name, CIGAR string, sequence, and feature type.

```javascript
jexl: get(feature, 'start') // start coordinate, 0-based half open
```

```javascript
jexl: get(feature, 'end') // end coordinate, 0-based half open
```

```javascript
jexl: get(feature, 'refName') // chromosome or reference sequence name
```

```javascript
jexl: get(feature, 'CIGAR') // BAM or CRAM feature CIGAR string
```

```javascript
jexl: get(feature, 'seq') // BAM or CRAM feature sequence
```

```javascript
jexl: get(feature, 'type') // feature type e.g. mRNA or gene
```

--------------------------------

### BamAdapter - Simplified Configuration

Source: https://jbrowse.org/jb2/docs/config/bamadapter

Use this pre-processor for minimal configuration, assuming your BAM file has a corresponding BAI index.

```json
{
  "type": "BamAdapter",
  "uri": "yourfile.bam"
}
```

--------------------------------

### Example FromConfigAdapter Configuration

Source: https://jbrowse.org/jb2/docs/config_guides/from_config

Use FromConfigAdapter to generate features directly from values stored in the configuration. This is useful for static feature sets defined within the configuration itself.

```json
{
  "type": "FromConfigAdapter",
  "features": [
    {
      "refName": "ctgA",
      "uniqueId": "alias1",
      "aliases": ["A", "contigA"]
    },
    {
      "refName": "ctgB",
      "uniqueId": "alias2",
      "aliases": ["B", "contigB"]
    }
  ]
}
```

--------------------------------

### MashMapAdapter Minimal Configuration

Source: https://jbrowse.org/jb2/docs/config/mashmapadapter

Use this configuration for a simplified setup of the MashMapAdapter. It requires specifying the adapter type, the URI of the output file, and the query and target assembly names.

```json
{
  "type": "MashMapAdapter",
  "uri": "file.out",
  "queryAssembly": "hg19",
  "targetAssembly": "hg38"
}
```

--------------------------------

### Set Show Vertical Guides

Source: https://jbrowse.org/jb2/docs/models/sharedldmodel

Toggles the visibility of vertical guides. Accepts a boolean value.

```typescript
setShowVerticalGuides: (show: boolean) => void
```

--------------------------------

### Install Custom Add Track Workflow in Plugin

Source: https://jbrowse.org/jb2/docs/developer_guides/creating_addtrack_workflow

Ensure your custom add track workflow component is installed within your plugin's main installation function. This makes the custom workflow available in the JBrowse interface.

```jsx
// plugins/wiggle/index.jsx  

// ...  

export default class WigglePlugin extends Plugin {
  name = 'WigglePlugin'
  
  install(pm: PluginManager) {
    // ...  
    MultiWiggleAddTrackWidgetF(pm)
    // ...  
  }
}

```

--------------------------------

### Serve JBrowse 2 Locally

Source: https://jbrowse.org/jb2/docs/quickstart_web

Starts a local web server in the JBrowse 2 directory using `npx serve`. This is required to view JBrowse 2 in a browser, as it cannot be opened directly from the file system.

```bash
cd jbrowse2/
```

```bash
npx serve .
```

```bash
npx serve -S .
```

--------------------------------

### Simplified NcbiSequenceReportAliasAdapter Config

Source: https://jbrowse.org/jb2/docs/config/ncbisequencereportaliasadapter

Use this simplified configuration for minimal setup. It specifies the adapter type and the URI of the sequence report file.

```json
{
  "type": "NcbiSequenceReportAliasAdapter",
  "uri": "sequence_report.tsv"
}
```

--------------------------------

### Example AlignmentsTrack Configuration

Source: https://jbrowse.org/jb2/docs/config_guides/alignments_track

This is a basic configuration for an Alignments track. It specifies the track ID, name, assembly, type, and adapter details for BAM files.

```json
{
  "trackId": "my_alignments_track",
  "name": "My Alignments",
  "assemblyNames": ["hg19"],
  "type": "AlignmentsTrack",
  "adapter": {
    "type": "BamAdapter",
    "bamLocation": {
      "uri": "http://yourhost/file.bam"
    },
    "index": {
      "location": {
        "uri": "http://yourhost/file.bam.bai"
      }
    }
  }
}
```

--------------------------------

### Custom Panel Sizes for Horizontal Split

Source: https://jbrowse.org/jb2/docs/urlparams

Create a horizontal split with custom proportional sizes for panels. This example sets a 70/30 width ratio.

```url
https://jbrowse.org/code/jb2/main/?config=test_data/volvox/config.json&session=spec-{"views":[{"type":"LinearGenomeView","assembly":"volvox","loc":"ctgA:1-5000","tracks":["gff3tabix_genes"]},{"type":"LinearGenomeView","assembly":"volvox","loc":"ctgB:1-5000","tracks":["gff3tabix_genes"]}],"layout":{"direction":"horizontal","children":[{"views":[0],"size":70},{"views":[1],"size":30}]}}
```

```json
{
  "views": [
    { "type": "LinearGenomeView", "assembly": "volvox", "loc": "ctgA:1-5000" },
    { "type": "LinearGenomeView", "assembly": "volvox", "loc": "ctgB:1-5000" }
  ],
  "layout": {
    "direction": "horizontal",
    "children": [
      { "views": [0], "size": 70 },
      { "views": [1], "size": 30 }
    ]
  }
}
```

--------------------------------

### Download JBrowse CLI Bundle

Source: https://jbrowse.org/jb2/docs/quickstart_web

Downloads the JBrowse CLI as a single executable file using `wget` and makes it executable with `chmod`. This method avoids npm installation.

```bash
wget https://unpkg.com/@jbrowse/cli/bundle/index.js -O jbrowse
```

```bash
chmod +x jbrowse
```

```bash
./jbrowse --help
```

--------------------------------

### Upgrade JBrowse Web

Source: https://jbrowse.org/jb2/docs/quickstart_web

Upgrade an existing JBrowse 2 installation to the latest version by running the jbrowse upgrade command in the installation directory.

```bash
# run this command in an existing jbrowse 2 installation
jbrowse upgrade
```

--------------------------------

### Configure TwoBitAdapter

Source: https://jbrowse.org/jb2/docs/config_guides/assemblies

Use the UCSC twoBit adapter. Note that 2bit format has a longer startup time due to upfront parsing.

```json
{
  "type": "TwoBitAdapter",
  "twoBitLocation": {
    "uri": "https://jbrowse.org/genomes/hg19/fasta/hg19.2bit",
    "locationType": "UriLocation"
  }
}
```

--------------------------------

### ReferenceSequenceTrack Configuration

Source: https://jbrowse.org/jb2/docs/config_guides/assemblies

Example configuration for a ReferenceSequenceTrack, used within the assembly section. It specifies the track type, ID, and adapter details for loading sequence data.

```json
{
  "type": "ReferenceSequenceTrack",
  "trackId": "refseq_track",
  "adapter": {
    "type": "BgzipFastaAdapter",
    "fastaLocation": {
      "uri": "https://jbrowse.org/genomes/hg19/fasta/hg19.fa.gz",
      "locationType": "UriLocation"
    },
    "faiLocation": {
      "uri": "https://jbrowse.org/genomes/hg19/fasta/hg19.fa.gz.fai",
      "locationType": "UriLocation"
    },
    "gziLocation": {
      "uri": "https://jbrowse.org/genomes/hg19/fasta/hg19.fa.gz.gzi",
      "locationType": "UriLocation"
    }
  },
  "rendering": {
    "type": "DivSequenceRenderer"
  }
}
```

--------------------------------

### jbrowse create

Source: https://jbrowse.org/jb2/docs/cli

Command to download and install the latest JBrowse 2 release, with options for specifying path, forcing overwrite, using URLs, tags, branches, or nightly builds.

```APIDOC
## jbrowse create

Downloads and installs the latest JBrowse 2 release

Usage: jbrowse create [localPath] [options]

Options:
  -h, --help                 Show help

  -f, --force                Overwrites existing JBrowse 2 installation if
                             present in path

  -l, --listVersions         Lists out all versions of JBrowse 2

      --branch               Download a development build from a named git
                             branch

      --nightly              Download the latest development build from the main
                             branch

  -u, --url                  A direct URL to a JBrowse 2 release

  -t, --tag                  Version of JBrowse 2 to install. Format is v1.0.0.
                             Defaults to latest

# Download latest release from github, and put in specific path
$ jbrowse create /path/to/new/installation

# Download latest release from github and force overwrite existing contents at path
$ jbrowse create /path/to/new/installation --force

# Download latest release from a specific URL
$ jbrowse create /path/to/new/installation --url url.com/directjbrowselink.zip

# Download a specific tag from github
$ jbrowse create /path/to/new/installation --tag v1.0.0

# List available versions
$ jbrowse create --listVersions
```

--------------------------------

### Toggle Vertical Guides on Hover

Source: https://jbrowse.org/jb2/docs/config/sharedlddisplay

Control the display of vertical guides that appear at connected genome positions when hovering over the display. The default is true.

```javascript
showVerticalGuides: {
  type: 'boolean',
  defaultValue: true
}
```

--------------------------------

### TrixTextSearchAdapter - Simplified Config

Source: https://jbrowse.org/jb2/docs/config/trixtextsearchadapter

Use this pre-processor configuration for minimal setup when the file.ixx also exists. It assumes default file locations and requires assembly names and a text search adapter ID.

```json
{
  "type": "TrixTextSearchAdapter",
  "uri": "file.ix",
  "assemblyNames": ["hg19"],
  "textSearchAdapterId": "hg19SearchIndex"
}
```

--------------------------------

### Show Vertical Guides Setting

Source: https://jbrowse.org/jb2/docs/models/sharedldmodel

Determines whether to show vertical guides at the connected genome positions on hover. Falls back to the configuration value if undefined.

```typescript
showVerticalGuidesSetting: types.maybe(types.boolean)
```

--------------------------------

### openLocation: Get authenticated file handle

Source: https://jbrowse.org/jb2/docs/models/baseinternetaccountmodel

Gets a file handle that uses fetch with authentication headers added. Use this to access remote files with authentication.

```typescript
// type signature  

openLocation: (location: UriLocation) => RemoteFileWithRangeCache  
```

--------------------------------

### Specify Configuration File with ?config=

Source: https://jbrowse.org/jb2/docs/urlparams

Use the `?config=` parameter to point to a JBrowse 2 configuration file. This uses client-side fetch.

```url
?config=test_data/volvox/config.json
```

--------------------------------

### Force Overwrite Existing JBrowse Installation

Source: https://jbrowse.org/jb2/docs/cli

Creates a new JBrowse 2 installation, overwriting any existing files at the specified path using the --force option.

```bash
# Download latest release from github and force overwrite existing contents at path  
$ jbrowse create /path/to/new/installation --force  
```

--------------------------------

### React-based Renderer Implementation

Source: https://jbrowse.org/jb2/docs/developer_guides/renderer_architecture

Example of a custom renderer extending FeatureRendererType. It demonstrates fetching features, passing them to the parent for React element creation, and returning features for serialization.

```javascript
class MyRenderer extends FeatureRendererType {
  async render(renderArgs) {
    // 1. Fetch features
    const features = await this.getFeatures(renderArgs)
  
    // 2. Pass to parent which creates React element
    const result = await super.render({ ...renderArgs, features })
  
    // 3. Return features for serialization
    return { ...result, features }
  }
}

```

--------------------------------

### Prepare FASTA file with samtools

Source: https://jbrowse.org/jb2/docs/tutorials/embed_linear_genome_view

Use samtools to prepare a FASTA file for JBrowse by compressing it with bgzip and creating a FASTA index.

```bash
bgzip file.fa

samtools faidx file.fa

```

--------------------------------

### Using Configuration Callbacks

Source: https://jbrowse.org/jb2/docs/developer_guides/config_model

Shows how to use configuration callbacks for dynamic values, such as color, by passing context variables like 'feature' to `readConfObject`. This allows for complex functions to determine configuration values based on feature attributes.

```javascript
readConfObject(config, 'color', { feature })
```

--------------------------------

### Upgrade JBrowse 2 Installation

Source: https://jbrowse.org/jb2/docs/cli

Updates your JBrowse 2 installation to the latest version or a specific tagged version. It can also be used to download development builds from branches or nightly builds.

```bash
jbrowse upgrade
```

```bash
jbrowse upgrade /path/to/jbrowse2/installation
```

--------------------------------

### Upgrade JBrowse 2 to a Specific Tag

Source: https://jbrowse.org/jb2/docs/cli

Use this command to upgrade your JBrowse 2 installation to a specific version tag from GitHub. Ensure you provide the correct path to your JBrowse 2 installation.

```bash
$ jbrowse upgrade /path/to/jbrowse2/installation --tag v1.0.0
```

--------------------------------

### Complete Assembly Configuration Example

Source: https://jbrowse.org/jb2/docs/config_guides/assemblies

This JSON snippet shows a full configuration for the hg19 assembly, including its name, aliases, sequence track details, and reference name aliasing.

```json
{
  "assemblies": [
    {
      "name": "hg19",
      "aliases": ["GRCh37"],
      "sequence": {
        "type": "ReferenceSequenceTrack",
        "trackId": "hg19_config",
        "adapter": {
          "type": "BgzipFastaAdapter",
          "fastaLocation": {
            "uri": "https://jbrowse.org/genomes/hg19/fasta/hg19.fa.gz",
            "locationType": "UriLocation"
          },
          "faiLocation": {
            "uri": "https://jbrowse.org/genomes/hg19/fasta/hg19.fa.gz.fai",
            "locationType": "UriLocation"
          },
          "gziLocation": {
            "uri": "https://jbrowse.org/genomes/hg19/fasta/hg19.fa.gz.gzi",
            "locationType": "UriLocation"
          }
        },
        "rendering": {
          "type": "DivSequenceRenderer"
        }
      },
      "refNameAliases": {
        "adapter": {
          "type": "RefNameAliasAdapter",
          "location": {
            "uri": "https://s3.amazonaws.com/jbrowse.org/genomes/hg19/hg19_aliases.txt",
            "locationType": "UriLocation"
          }
        }
      }
    }
  ]
}
```

--------------------------------

### setShowVerticalGuides

Source: https://jbrowse.org/jb2/docs/models/sharedldmodel

Toggles the visibility of vertical guides in the visualization.

```APIDOC
## setShowVerticalGuides

### Description
Toggles the visibility of vertical guides in the visualization.

### Method
`setShowVerticalGuides(show: boolean) => void`

### Parameters
#### Path Parameters
- None

#### Query Parameters
- None

#### Request Body
- None

### Request Example
```javascript
setShowVerticalGuides(true);
setShowVerticalGuides(false);
```

### Response
#### Success Response (200)
- None (void function)

#### Response Example
- None
```

--------------------------------

### MCScanSimpleAnchorsAdapter - Minimal Configuration

Source: https://jbrowse.org/jb2/docs/config/mcscansimpleanchorsadapter

Use this configuration for a simplified setup of the MCScanSimpleAnchorsAdapter. It requires the adapter type, the main anchor file URI, and paths to two BED files, along with assembly names.

```json
{
  "type": "MCScanSimpleAnchorsAdapter",
  "uri": "file.anchors",
  "bed1": "bed1.bed",
  "bed2": "bed2.bed",
  "assemblyNames": ["hg19", "hg38"]
}
```

--------------------------------

### Get Canonical Ref Name Method

Source: https://jbrowse.org/jb2/docs/models/assembly

Returns the canonical reference sequence name for a given alias or refName. Note that this may differ from the FASTA file name if `refNameAliases` with `override:true` are configured. Use `getSeqAdapterRefName()` to get the FASTA file name.

```typescript
getCanonicalRefName: (refName: string) => string
```

--------------------------------

### setPluginsUpdated Action

Source: https://jbrowse.org/jb2/docs/models/jbrowsedesktoprootmodel

Triggers an update process for the installed plugins.

```APIDOC
## Action: setPluginsUpdated

### Description
Initiates the process to update the plugins installed in the JBrowse Desktop application.

### Type Signature
```typescript
setPluginsUpdated: () => Promise<void>
```
```

--------------------------------

### Get LinearComparativeDisplay Height

Source: https://jbrowse.org/jb2/docs/models/linearcomparativedisplay

Retrieves the rendered height of the display.

```typescript
height: number
```

--------------------------------

### Get Configuration Method

Source: https://jbrowse.org/jb2/docs/models/assembly

Retrieves a specific configuration value by its key.

```typescript
getConf: (arg: string) => any
```

--------------------------------

### Initialize Project with Yarn

Source: https://jbrowse.org/jb2/docs/developer_guides/simple_plugin

Initialize your JBrowse plugin project using yarn. Ensure you provide a descriptive name for your plugin when prompted.

```bash
yarn init
```

--------------------------------

### Get All Connections - Getter

Source: https://jbrowse.org/jb2/docs/models/connectionmanagementsessionmixin

A getter that returns an array of all current connection instances.

```typescript
connections: ({ [x: string]: any; } & NonEmptyObject & { setSubschema(slotName: string, data: Record<string, unknown>): Record<string, unknown> | ({ [x: string]: any; } & NonEmptyObject & { ...; } & IStateTreeNode<...>); } & IStateTreeNode<...>)[]
```

--------------------------------

### Create a New JBrowse 2 Instance

Source: https://jbrowse.org/jb2/docs/quickstart_web

Creates a new JBrowse 2 instance by downloading the latest `jbrowse-web` and extracting it into a specified directory. The directory name can be customized.

```bash
jbrowse create jbrowse2
```

--------------------------------

### moveTo

Source: https://jbrowse.org/jb2/docs/models/lineargenomeview

Moves the view to a specified start and end position within a displayed region.

```APIDOC
## moveTo

### Description
Moves the view to a specified start and end position within a displayed region. The offset is the base-pair offset in the displayed region, and the index is the index of the displayed region in the linear genome view.

### Method
moveTo

### Parameters
#### Path Parameters
- **start** (BpOffset) - Optional - The starting offset.
- **end** (BpOffset) - Optional - The ending offset.
```

--------------------------------

### Make Linux AppImage Executable and Run

Source: https://jbrowse.org/jb2/docs/quickstart_desktop

Use these terminal commands to make the JBrowse desktop AppImage executable and then launch it. This only needs to be done once.

```bash
# Make the AppImage file executable, only need to do this once  

chmod  a+x jbrowse-desktop-*-linux.AppImage  

# Run!  

./jbrowse-desktop-*-linux.AppImage  

```

--------------------------------

### Get Adapter Render Properties

Source: https://jbrowse.org/jb2/docs/models/linearpileupdisplay

This method returns properties required by the adapter for rendering.

```typescript
adapterRenderProps: () => any
```

--------------------------------

### Example FromConfigSequenceAdapter Configuration

Source: https://jbrowse.org/jb2/docs/config_guides/from_config

FromConfigSequenceAdapter provides similar functionality to FromConfigAdapter but is optimized for performance when dealing with sequence features. It allows defining sequence data directly within the configuration.

```json
{
  "type": "FromConfigSequenceAdapter",
  "features": [
    {
      "refName": "SEQUENCE_1",
      "uniqueId": "firstId",
      "start": 0,
      "end": 33,
      "seq": "CCAAGATCTAAGATGTCAACACCTATCTGCTCA"
    },
    {
      "refName": "SEQUENCE_2",
      "uniqueId": "secondId",
      "start": 0,
      "end": 44,
      "seq": "CCGAACCACAGGCCTATGTTACCATTGGAAAGCTCACCTTCCCG"
    }
  ]
}
```

--------------------------------

### Get LinearArcDisplay Renderer Configuration

Source: https://jbrowse.org/jb2/docs/models/lineararcdisplay

This getter returns the configuration for the renderer used by the LinearArcDisplay.

```typescript
rendererConfig: "renderer"
```

--------------------------------

### Get LinearArcDisplay Render Delay

Source: https://jbrowse.org/jb2/docs/models/lineararcdisplay

This getter returns the render delay for the LinearArcDisplay, which is a number.

```typescript
renderDelay: 0
```

--------------------------------

### jbrowse upgrade

Source: https://jbrowse.org/jb2/docs/cli

Commands for upgrading JBrowse 2 installations to specific versions or from various sources.

```APIDOC
## jbrowse upgrade

Commands for upgrading JBrowse 2 installations.

### Usage
```bash
jbrowse upgrade [/path/to/jbrowse2/installation] [--tag <version>] [--listVersions] [--url <url>] [--nightly]
```

### Options
- `--tag <version>`: Upgrade to a specific tag (version).
- `--listVersions`: List available versions on GitHub.
- `--url <url>`: Upgrade from a specific URL.
- `--nightly`: Get the nightly release from the main branch.

### Examples
```bash
# Upgrade to a specific tag
jbrowse upgrade /path/to/jbrowse2/installation --tag v1.0.0

# List versions available on github
jbrowse upgrade --listVersions

# Upgrade from a specific URL
jbrowse upgrade --url https://sample.com/jbrowse2.zip

# Get nightly release from main branch
jbrowse upgrade --nightly
```
```

--------------------------------

### HicAdapter Basic Configuration

Source: https://jbrowse.org/jb2/docs/config/hicadapter

Use this minimal configuration to set up the HicAdapter with a specified Hi-C file. Ensure the 'uri' points to your '.hic' file.

```json
{
  "type": "HicAdapter",
  "uri": "file.hic"
}
```

--------------------------------

### VcfAdapter Minimal Configuration

Source: https://jbrowse.org/jb2/docs/config/vcfadapter

Use this minimal configuration for basic VCF file loading. Ensure the 'uri' points to your VCF file.

```json
{
  "type": "VcfAdapter",
  "uri": "yourfile.vcf"
}
```

--------------------------------

### setOffsets

Source: https://jbrowse.org/jb2/docs/models/lineargenomeview

Sets the left and right offsets for the rubberband selection, used in the get sequence dialog.

```APIDOC
## setOffsets

### Description
Sets the left and right offsets for the rubberband selection, used in the get sequence dialog. You can call `view.getSelectedRegions(view.leftOffset, view.rightOffset)` to compute the selected regions from the offsets.

### Method
setOffsets

### Parameters
#### Path Parameters
- **left** (BpOffset) - Optional - The left offset.
- **right** (BpOffset) - Optional - The right offset.

### Return Value
(void)
```

--------------------------------

### Get LinearArcDisplay Display Mode Setting

Source: https://jbrowse.org/jb2/docs/models/lineararcdisplay

This getter returns the display mode setting for the LinearArcDisplay.

```typescript
displayModeSetting: "displayMode"
```

--------------------------------

### Configure TwoBitAdapter with Chrom Sizes

Source: https://jbrowse.org/jb2/docs/config_guides/assemblies

Optionally specify a .chrom.sizes file to speed up 2bit loading, especially for assemblies with many chromosomes.

```json
{
  "type": "TwoBitAdapter",
  "twoBitLocation": {
    "uri": "https://jbrowse.org/genomes/hg19/fasta/hg19.2bit",
    "locationType": "UriLocation"
  },
  "chromSizesLocation": {
    "uri": "https://jbrowse.org/genomes/hg19/fasta/hg19.chrom.sizes",
    "locationType": "UriLocation"
  }
}
```

--------------------------------

### MCScanAnchorsAdapter - Pre-processor / simplified config

Source: https://jbrowse.org/jb2/docs/config/mcscananchorsadapter

This configuration provides a simplified way to set up the MCScanAnchorsAdapter with essential parameters.

```APIDOC
## MCScanAnchorsAdapter - Pre-processor / simplified config

preprocessor to allow minimal config:

```json
{
  "type": "MCScanAnchorsAdapter",
  "uri": "file.anchors",
  "bed1": "bed1.bed",
  "bed2": "bed2.bed",
  "assemblyNames": ["hg19", "hg38"]
}
```
```

--------------------------------

### Get LinearArcDisplay Block Type

Source: https://jbrowse.org/jb2/docs/models/lineararcdisplay

This getter returns the type of block used by the LinearArcDisplay, which is a string.

```typescript
blockType: "LinearArcDisplay"
```

--------------------------------

### Get LinearComparativeDisplay Level

Source: https://jbrowse.org/jb2/docs/models/linearcomparativedisplay

Retrieves the current level of the display, typically used for zoom or detail.

```typescript
level: number
```

--------------------------------

### Action to Set Line Width

Source: https://jbrowse.org/jb2/docs/models/linearreadarcsdisplaysettingsmixin

Sets the line width for arcs. For example, thin=1, bold=2, extrabold=5.

```typescript
setLineWidth: (n: number) => void
```

--------------------------------

### Dynamically Add Track with &sessionTracks=

Source: https://jbrowse.org/jb2/docs/urlparams

Use `&sessionTracks=` to dynamically add a track to the session, including tracks defined with `FromConfigAdapter` for inline feature data.

```url
https://jbrowse.org/code/jb2/main/?config=test_data/volvox/config.json&loc=ctgA:1-800&assembly=volvox&tracks=gff3tabix_genes,volvox_filtered_vcf,volvox_microarray,volvox_cram,url_track&sessionTracks=[{"type":"FeatureTrack","trackId":"url_track","name":"URL track","assemblyNames":["volvox"],"adapter":{"type":"FromConfigAdapter","features":[{"uniqueId":"one","refName":"ctgA","start":190,"end":191,"name":"Boris"}}]}]
```

--------------------------------

### Defining a Configuration Schema with a Sub-Schema

Source: https://jbrowse.org/jb2/docs/developer_guides/config_model

Example of defining a ConfigurationSchema for BamAdapter, including a nested ConfigurationSchema for its index.

```typescript
ConfigurationSchema(
  'BamAdapter',
  {
    bamLocation: {
      type: 'fileLocation',
      defaultValue: { uri: '/path/to/my.bam', locationType: 'UriLocation' },
    },
    index: ConfigurationSchema('BamIndex', {
      indexType: {
        model: types.enumeration('IndexType', ['BAI', 'CSI']),
        type: 'stringEnum',
        defaultValue: 'BAI',
      },
      location: {
        type: 'fileLocation',
        defaultValue: {
          uri: '/path/to/my.bam.bai',
          locationType: 'UriLocation',
        },
      },
    }),
  },
  { explicitlyTyped: true },
)
```

--------------------------------

### Get LinearArcDisplay Renderer Type Name

Source: https://jbrowse.org/jb2/docs/models/lineararcdisplay

This getter returns the type name of the renderer used by the LinearArcDisplay.

```typescript
rendererTypeName: "LinearArcRenderer"
```

--------------------------------

### Get Renderer Type Name for LinearBareDisplay

Source: https://jbrowse.org/jb2/docs/models/linearbaredisplay

This getter returns the type name of the renderer associated with LinearBareDisplay.

```typescript
rendererTypeName: any
```

--------------------------------

### Prepare and Add VCF Track

Source: https://jbrowse.org/jb2/docs/quickstart_web

Compress and index VCF files using bgzip and tabix before adding them as a track. If the VCF is not sorted, use bcftools to sort it first.

```bash
bgzip file.vcf

tabix file.vcf.gz

jbrowse add-track file.vcf.gz --load copy --out /var/www/html/jbrowse
```

```bash
bcftools sort file.vcf > file.sorted.vcf

bgzip file.sorted.vcf

tabix file.sorted.vcf.gz
```

```bash
bcftools view volvox.vcf --output-type z > volvox.vcf.gz

rm volvox.vcf

bcftools index --tbi volvox.vcf.gz
```

--------------------------------

### Add Global Menu Item with No-Build Plugin

Source: https://jbrowse.org/jb2/docs/developer_guides/no_build_plugin

This example demonstrates adding a new menu to the JBrowse toolbar and appending a menu item to it using the `configure` method. Ensure to check for `pluginManager.rootModel` existence as `configure` can be called in a web worker.

```javascript
export default class MyPlugin {
  name = 'MyPlugin'
  version = '1.0'
  install() {}
  configure(pluginManager) {
    if (pluginManager.rootModel) {
      pluginManager.rootModel.insertMenu('Citations', 4)
      pluginManager.rootModel.appendToMenu('Citations', {
        label: 'Cite this JBrowse session',
        onClick: session => {
          /* do nothing for now, see below for example */
        },
      })
    }
  }
}
```

--------------------------------

### Get Adapter Map Entry Method

Source: https://jbrowse.org/jb2/docs/models/assembly

Retrieves a map entry for a given adapter configuration and options.

```typescript
getAdapterMapEntry: (adapterConf: AdapterConf, options: BaseOptions) => Promise<RefNameMap>
```