Hybracter

https://hybracter.readthedocs.io/en/latest/
Admin
Hybracter is an automated long-read-first bacterial genome assembly pipeline designed for scalable...
Tokens:30,067
Snippets:167
Trust Score:9.6
Update:3 weeks ago
Show doc for...
Tokens:
Raw
### Install miniforge

Source: https://hybracter.readthedocs.io/en/latest/install

Install miniforge and follow the prompts.

```bash
sh Miniforge3-Linux-x86_64.sh
```

--------------------------------

### Install miniconda

Source: https://hybracter.readthedocs.io/en/latest/install

Install miniconda and follow the prompts.

```bash
sh Miniconda3-latest-Linux-x86_64.sh
```

--------------------------------

### Download miniforge installer for Linux

Source: https://hybracter.readthedocs.io/en/latest/install

Download the miniforge installer for Linux x86_64. For other architectures, replace the URL.

```bash
curl -O https://github.com/conda-forge/miniforge/releases/latest/download/Miniforge3-Linux-x86_64.sh
```

--------------------------------

### Copy example Slurm profile files

Source: https://hybracter.readthedocs.io/en/latest/profiles

Copy the example Slurm profile files (config.yaml and slurm-status.py) into the new profile directory.

```bash
# go to your new profile directory
cd ~/.config/snakemake/slurm/
# copy the files (either from GitHub or from where you installed hybracter)
wget https://raw.githubusercontent.com/gbouras13/hybracter/main/profiles/slurm/config.yaml
wget https://raw.githubusercontent.com/gbouras13/hybracter/main/profiles/slurm/slurm_status.py

```

--------------------------------

### Download miniforge installer for Mac

Source: https://hybracter.readthedocs.io/en/latest/install

Download the miniforge installer for Mac (Intel, will also work with M1).

```bash
curl -O https://github.com/conda-forge/miniforge/releases/latest/download/Miniforge3-MacOSX-x86_64.sh
```

--------------------------------

### Install Hybracter with Pip

Source: https://hybracter.readthedocs.io/en/latest/install

Creates a conda environment with pip, activates it, installs hybracter via pip, and verifies with hybracter --help and hybracter install. Requires conda to be available for dependency installation.

```bash
conda create -n hybracterENV pip
conda activate hybracterENV
pip install hybracter
hybracter --help
hybracter install

```

--------------------------------

### Install pbtk with conda

Source: https://hybracter.readthedocs.io/en/latest/input

Creates a conda environment named 'pacbio' and installs pbtk from bioconda. Activate the environment before using the extraction commands.

```bash
conda create -n pacbio -c bioconda pbtk
conda activate pacbio
```

--------------------------------

### Download miniconda installer for Linux

Source: https://hybracter.readthedocs.io/en/latest/install

Download the miniconda installer for Linux x86_64. For other architectures, replace the URL.

```bash
curl -O https://repo.anaconda.com/miniconda/Miniconda3-latest-Linux-x86_64.sh
```

--------------------------------

### Install Hybracter with Conda

Source: https://hybracter.readthedocs.io/en/latest/install

Creates a conda environment named hybracterENV, installs hybracter from bioconda and conda-forge, then activates the environment and verifies the installation with hybracter --help and hybracter install.

```bash
conda create -n hybracterENV  -c bioconda -c conda-forge  hybracter
conda activate hybracterENV
hybracter --help
hybracter install

```

--------------------------------

### Example comparison output from compare_assemblies.py

Source: https://hybracter.readthedocs.io/en/latest/output

Example visual representation from the comparisons directory showing differences between polishing rounds for a sample. The asterisk (*) marks the position of each difference. An empty file indicates no differences between assemblies.

```text
    contig_1 37368-37398: ACCATTTTTGTTTTATTTTTTGTAAAGACAC
    contig_1 37368-37397: ACCATTTTTGTTTTA-TTTTTGTAAAGACAC
                                         *              

    contig_1 43247-43277: CAACGTTGTTTTCCCTGAGCCTAAATAACCA
    contig_1 43246-43276: CAACGTTGTTTTCCCCGAGCCTAAATAACCA
                                         *              

    contig_1 44658-44688: CTTGATCTTTATCTATGATTTCATTAATACT
    contig_1 44657-44687: CTTGATCTTTATCTACGATTTCATTAATACT
                                         *              

```

--------------------------------

### Install hybracter databases to a custom directory

Source: https://hybracter.readthedocs.io/en/latest/install

Installs the hybracter databases to a specified directory using the -d or --databases flag.

```bash
hybracter install -d <database directory>

```

--------------------------------

### Download miniconda installer for Mac

Source: https://hybracter.readthedocs.io/en/latest/install

Download the miniconda installer for Mac (Intel, will also work with M1).

```bash
curl -O https://repo.anaconda.com/miniconda/Miniconda3-latest-MacOSX-x86_64.sh
```

--------------------------------

### Install Hybracter from Source

Source: https://hybracter.readthedocs.io/en/latest/install

Clones the development version of hybracter from GitHub, installs it in editable mode with pip, and verifies with hybracter --help. This version may include untested features.

```bash
git clone https://github.com/gbouras13/hybracter.git
cd hybracter
pip install -e .
hybracter --help

```

--------------------------------

### Install hybracter databases

Source: https://hybracter.readthedocs.io/en/latest/install

Installs the hybracter databases (consisting of a plassembler database). Note: users have reported errors due to an MD5 file error caused by Zenodo issues; waiting a few minutes and trying again usually works.

```bash
hybracter install

```

--------------------------------

### hybracter -h command

Source: https://hybracter.readthedocs.io/en/latest/input

Run 'hybracter -h' to display the help message, which lists all available commands and options. The output shows the usage, options, and the list of commands including install, hybrid, hybrid-single, long, long-single, test-hybrid, test-long, config, citation, and version.

```bash
hybracter -h 
```

--------------------------------

### hybracter install

Source: https://hybracter.readthedocs.io/en/latest/run

Installs the hybracter databases. Optionally specify a directory to store them, which must be provided later with -d when running hybracter.

```APIDOC
## hybracter install

### Description
Installs the hybracter databases required for running hybracter.

### Usage
```
hybracter install
```

### Options
- `-d <databases directory>` (string) - Optional - Directory to store databases. Must be specified with `-d` when running hybracter.

### Example
```
hybracter install -d <databases directory>
```
```

--------------------------------

### Run hybracter hybrid test

Source: https://hybracter.readthedocs.io/en/latest/install

Run a test to verify hybracter installs all required dependencies. Takes 5-10 minutes.

```bash
hybracter test-hybrid --threads 8

```

--------------------------------

### Run Hybracter with Docker

Source: https://hybracter.readthedocs.io/en/latest/install

Pulls the Hybracter Docker image (v0.11.0) and runs a hybrid-single assembly with test fastqs, mounting local directories for input and output. The container includes the database and all dependencies, so no separate install or database directory is needed.

```bash
docker pull quay.io/gbouras13/hybracter:0.11.0
docker run quay.io/gbouras13/hybracter:0.11.0  hybracter -h
# -v mounts directories from your local filesystem to the docker contaier
docker run --rm -v /path/to/my/test/fastqs:/data -v /path/to/where/i/want/the/output:/output quay.io/gbouras13/hybracter:0.11.0 hybracter hybrid-single \
  -l /data/test_long_reads.fastq.gz \
  -1 /data/test_short_reads_R1.fastq.gz \
  -2 /data/test_short_reads_R2.fastq.gz \
  -o /output/output_test_docker -t 4 –auto 

```

--------------------------------

### Run Hybracter with Singularity

Source: https://hybracter.readthedocs.io/en/latest/install

Pulls the Hybracter Docker image (v0.10.0) using singularity, sets the container path, and runs a hybrid-single assembly with test fastqs. The container includes the database and all dependencies, so no separate install or database directory is needed.

```bash
IMAGE_DIR="<the directory you want the .sif file to be in >"
singularity pull --dir $IMAGE_DIR docker://quay.io/gbouras13/hybracter:0.10.0

container="$IMAGE_DIR/hybracter_0.10.0.sif"

# example command with test fastqs
 singularity exec $container    hybracter hybrid-single -l test_data/Fastqs/test_long_reads.fastq.gz \
 -1 test_data/Fastqs/test_short_reads_R1.fastq.gz  -2 test_data/Fastqs/test_short_reads_R2.fastq.gz \
 -o output_test_singularity -t 4 -c 50000

```

--------------------------------

### Create hybracter environment with miniforge

Source: https://hybracter.readthedocs.io/en/latest/install

Create a fresh conda environment named hybracterENV with hybracter installed, activate it, and verify with hybracter -h.

```bash
conda create -n hybracterENV hybracter
conda activate hybracterENV
hybracter -h

```

--------------------------------

### hybracter long-single CLI options and defaults

Source: https://hybracter.readthedocs.io/en/latest/run

Command-line help output for hybracter long-single, listing all options, defaults, and constraints. Note the --min_depth behavior: Hybracter errors and exits if a sample has less than min_depth*chromosome_size bases of long-reads left after filtlong and porechop-ABI steps. The --mac flag installs Medaka v1.8.0 on Mac because higher versions break.

```bash
Usage: hybracter long-single [OPTIONS] [SNAKE_ARGS]...

  Run hybracter long on 1 isolate
Options:
  -l, --longreads TEXT            FASTQ file of longreads  [required]
  -s, --sample TEXT               Sample name.  [default: sample]
  -c, --chromosome INTEGER        FApproximate lower-bound chromosome length
                                  (in base pairs).  [default: 1000000]
  -o, --output PATH               Output directory  [default: hybracter_out]
  --configfile TEXT               Custom config file [default: config.yaml]
  -t, --threads INTEGER           Number of threads to use  [default: 1]
  --min_length INTEGER            min read length for long reads  [default:
                                  1000]
  --min_quality INTEGER           min read quality score for long reads in bp.
                                  [default: 9]
  --skip_qc                       Do not run porechop_abi, filtlong and fastp
                                  to QC the reads
  -d, --databases PATH            Plassembler Databases directory.
  --subsample_depth INTEGER       subsampled long read depth to subsample with
                                  Filtlong. By default is 100x.  [default:
                                  100]
  --min_depth INTEGER             minimum long read depth to continue the run.
                                  By default is 0x. Hybracter will error and
                                  exit if a sample has less than
                                  min_depth*chromosome_size bases of long-
                                  reads left AFTER filtlong and porechop-ABI
                                  steps are run.  [default: 0]
  --medakaModel [r1041_e82_400bps_sup_v5.0.0|r1041_e82_400bps_hac_v5.0.0|r1041_e82_400bps_hac_v4.3.0|r1041_e82_400bps_sup_v4.3.0|r1041_e82_400bps_hac_v4.2.0|r1041_e82_400bps_sup_v4.2.0|r941_sup_plant_g610|r941_min_fast_g507|r941_prom_fast_g507|r941_min_fast_g303|r941_min_high_g303|r941_min_high_g330|r941_prom_fast_g303|r941_prom_high_g303|r941_prom_high_g330|r941_min_high_g344|r941_min_high_g351|r941_min_high_g360|r941_prom_high_g344|r941_prom_high_g360|r941_prom_high_g4011|r10_min_high_g303|r10_min_high_g340|r103_min_high_g345|r103_min_high_g360|r103_prom_high_g360|r103_fast_g507|r103_hac_g507|r103_sup_g507|r104_e81_fast_g5015|r104_e81_sup_g5015|r104_e81_hac_g5015|r104_e81_sup_g610|r1041_e82_400bps_hac_g615|r1041_e82_400bps_fast_g615|r1041_e82_400bps_fast_g632|r1041_e82_260bps_fast_g632|r1041_e82_400bps_hac_g632|r1041_e82_400bps_sup_g615|r1041_e82_260bps_hac_g632|r1041_e82_260bps_sup_g632|r1041_e82_400bps_hac_v4.0.0|r1041_e82_400bps_sup_v4.0.0|r1041_e82_260bps_hac_v4.0.0|r1041_e82_260bps_sup_v4.0.0|r1041_e82_260bps_hac_v4.1.0|r1041_e82_260bps_sup_v4.1.0|r1041_e82_400bps_hac_v4.1.0|r1041_e82_400bps_sup_v4.1.0|r941_min_high_g340_rle|r941_min_hac_g507|r941_min_sup_g507|r941_prom_hac_g507|r941_prom_sup_g507|r941_e81_fast_g514|r941_e81_hac_g514|r941_e81_sup_g514]
                                  Medaka Model.  [default:
                                  r1041_e82_400bps_sup_v5.0.0]
  --flyeModel [--nano-hq|--nano-corr|--nano-raw|--pacbio-raw|--pacbio-corr|--pacbio-hifi]
                                  Flye Assembly Parameter  [default: --nano-
                                  hq]
  --contaminants PATH             Contaminants FASTA file to map long
                                  readsagainst to filter out. Choose
                                  --contaminants lambda to filter out phage
                                  lambda long reads.
  --dnaapler_custom_db PATH       Custom amino acid FASTA file of sequences to
                                  be used as a database with dnaapler custom.
  --no_medaka                     Do not polish the long read assembly with
                                  Medaka.
  --auto                          Automatically estimate the chromosome size
                                  using KMC.
  --depth_filter FLOAT            Depth filter to pass to Plassembler. Filters
                                  out all putative plasmid contigs below this
                                  fraction of the chromosome read depth (needs
                                  to be below in both long and short read sets
                                  for hybrid).
  --mac                           If you are running Hybracter on Mac -
                                  installs v1.8.0 of Medaka as higher versions
                                  break.

```

--------------------------------

### Example conda environment error log

Source: https://hybracter.readthedocs.io/en/latest/install

Example error log from hybracter.log showing a failed rule (plassembler_long) with paths to input, output, log, and conda-env. Use this to locate the conda environment that failed to install.

```text
Error in rule plassembler_long:
    jobid: 56
    input: hybracter_out/processing/qc/Sample1_filt_trim.fastq.gz
    output: hybracter_out/processing/plassembler/Sample1/plassembler_plasmids.fasta, hybracter_out/processing/plassembler/Sample1/plassembler_summary.tsv, hybracter_out/versions/Sample1/plassembler.version
    log: hybracter_out/stderr/plassembler_long/Sample1.log (check log file(s) for error details)
    conda-env: <path to conda env>

```

--------------------------------

### Create profile directory

Source: https://hybracter.readthedocs.io/en/latest/profiles

Create a directory for the new Slurm profile.

```bash
mkdir -p ~/.config/snakemake/slurm

```

--------------------------------

### Index PacBio BAM file with pbindex

Source: https://hybracter.readthedocs.io/en/latest/input

Creates a .pbi index file for the PacBio BAM file, required before extracting fastq.

```bash
pbindex yourpacbiofile.bam
```

--------------------------------

### Output fastq filename

Source: https://hybracter.readthedocs.io/en/latest/input

The command produces a gzipped fastq file named 'yourfastqfilename.fastq.gz'.

```text
yourfastqfilename.fastq.gz
```

--------------------------------

### hybracter hybrid-single CLI options and defaults

Source: https://hybracter.readthedocs.io/en/latest/run

Command-line help output for hybracter hybrid-single, showing all options and defaults. Note the --min_depth behavior: hybracter errors and exits if a sample has less than min_depth*chromosome_size bases of long-reads left after filtlong and porechop-ABI steps.

```bash
Usage: hybracter hybrid-single [OPTIONS] [SNAKE_ARGS]...

  Run hybracter hybrid on 1 isolate

Options:
  -l, --longreads TEXT            FASTQ file of longreads  [required]
  -1, --short_one TEXT            R1 FASTQ file of paired end short reads
                                  [required]
  -2, --short_two TEXT            R2 FASTQ file of paired end short reads
                                  [required]
  -s, --sample TEXT               Sample name.  [default: sample]
  -c, --chromosome INTEGER        Approximate lower-bound chromosome length
                                  (in base pairs).  [default: 1000000]
  --no_pypolca                    Do not use pypolca to polish assemblies with
                                  short reads
  --logic [best|last]             Hybracter logic to select best assembly. Use
                                  --best to pick best assembly based on ALE
                                  (hybrid) or pyrodigal mean length (long).
                                  Use --last to pick the last polishing round
                                  regardless.  [default: last]
  -o, --output PATH               Output directory  [default: hybracter_out]
  --configfile TEXT               Custom config file [default: config.yaml]
  -t, --threads INTEGER           Number of threads to use  [default: 1]
  --min_length INTEGER            min read length for long reads  [default:
                                  1000]
  --min_quality INTEGER           min read quality score for long reads in bp.
                                  [default: 9]
  --skip_qc                       Do not run porechop_abi, filtlong and fastp
                                  to QC the reads
  -d, --databases PATH            Plassembler Databases directory.
  --subsample_depth INTEGER       subsampled long read depth to subsample with
                                  Filtlong. By default is 100x.  [default:
                                  100]
  --min_depth INTEGER             minimum long read depth to continue the run.
                                  By default is 0x. Hybracter will error and
                                  exit if a sample has less than
                                  min_depth*chromosome_size bases of long-
                                  reads left AFTER filtlong and porechop-ABI
                                  steps are run.  [default: 0]
  --medakaModel [r1041_e82_400bps_sup_v5.0.0|r1041_e82_400bps_hac_v5.0.0|r1041_e82_400bps_hac_v4.3.0|r1041_e82_400bps_sup_v4.3.0|r1041_e82_400bps_hac_v4.2.0|r1041_e82_400bps_sup_v4.2.0|r941_sup_plant_g610|r941_min_fast_g507|r941_prom_fast_g507|r941_min_fast_g303|r941_min_high_g303|r941_min_high_g330|r941_prom_fast_g303|r941_prom_high_g303|r941_prom_high_g330|r941_min_high_g344|r941_min_high_g351|r941_min_high_g360|r941_prom_high_g344|r941_prom_high_g360|r941_prom_high_g4011|r10_min_high_g303|r10_min_high_g340|r103_min_high_g345|r103_min_high_g360|r103_prom_high_g360|r103_fast_g507|r103_hac_g507|r103_sup_g507|r104_e81_fast_g5015|r104_e81_sup_g5015|r104_e81_hac_g5015|r104_e81_sup_g610|r1041_e82_400bps_hac_g615|r1041_e82_400bps_fast_g615|r1041_e82_400bps_fast_g632|r1041_e82_260bps_fast_g632|r1041_e82_400bps_hac_g632|r1041_e82_400bps_sup_g615|r1041_e82_260bps_hac_g632|r1041_e82_260bps_sup_g632|r1041_e82_400bps_hac_v4.0.0|r1041_e82_400bps_sup_v4.0.0|r1041_e82_260bps_hac_v4.0.0|r1041_e82_260bps_sup_v4.0.0|r1041_e82_260bps_hac_v4.1.0|r1041_e82_260bps_sup_v4.1.0|r1041_e82_400bps_hac_v4.1.0|r1041_e82_400bps_sup_v4.1.0|r941_min_high_g340_rle|r941_min_hac_g507|r941_min_sup_g507|r941_prom_hac_g507|r941_prom_sup_g507|r941_e81_fast_g514|r941_e81_hac_g514|r941_e81_sup_g514]
                                  Medaka Model.  [default:
                                  r1041_e82_400bps_sup_v5.0.0]
  --flyeModel [--nano-hq|--nano-corr|--nano-raw|--pacbio-raw|--pacbio-corr|--pacbio-hifi]
                                  Flye Assembly Parameter  [default: --nano-
                                  hq]
  --contaminants PATH             Contaminants FASTA file to map long
                                  readsagainst to filter out. Choose
                                  --contaminants lambda to filter out phage
                                  lambda long reads.

```

--------------------------------

### Use Slurm profile with hybracter

Source: https://hybracter.readthedocs.io/en/latest/profiles

Use the installed Slurm profile with hybracter.

```bash
hybracter test-hybrid --profile slurm

```

--------------------------------

### Add conda channels after miniforge installation

Source: https://hybracter.readthedocs.io/en/latest/install

Add the defaults, bioconda, and conda-forge channels to your conda configuration.

```bash
conda config --add channels defaults
conda config --add channels bioconda
conda config --add channels conda-forge

```
Tokens:
Raw