### Run Dragen Analysis on Local Server (BCL Input) Source: https://help.dragen.illumina.com/product-guide/dragen-v4.4/dragen-apps/dragen-heme-wgs-to-pipeline/quick-start This snippet shows how to initiate a Dragen analysis on a local server starting from BCL files. It requires specifying the input and output folders. Use '--help' for a full list of parameters. ```bash --help # list all supported parameters --inputType bcl \ --inputFolder /staging/input-folder \ --analysisFolder /staging/output-folder ``` -------------------------------- ### Install DRAGEN License from File (Offline) Source: https://help.dragen.illumina.com/reference/licensing/onprem_licensing This command installs a DRAGEN license from a specified binary file (.bin). This method is primarily intended for dark site (offline) systems where automatic retrieval is not possible. Each license file must be installed individually. ```bash sudo dragen_lic -i .bin ``` ```bash sudo dragen_lic -i license_genome.bin ``` ```bash sudo dragen_lic -i license_compression.bin ``` ```bash sudo dragen_lic -i license_cnv.bin ``` ```bash sudo dragen_lic -i license_somatic.bin ``` ```bash sudo dragen_lic -i license_transcriptome.bin ``` ```bash sudo dragen_lic -i license_jointgenotype.bin ``` -------------------------------- ### Install Heme Pipeline Source: https://help.dragen.illumina.com/product-guide/dragen-v4.4/dragen-apps/dragen-heme-wgs-to-pipeline/installation Launches the Heme pipeline installer with root privileges. This command initiates the installation process on the DRAGEN server. ```shell sudo /path/to/install_Heme_WGS_TO_v{version}.run ``` -------------------------------- ### Launch DRAGEN Pipeline Installer Source: https://help.dragen.illumina.com/product-guide/dragen-v4.4/dragen-apps/dragen-solid-wgs-tn-pipeline/installation Executes the DRAGEN pipeline installer with root privileges. This command initiates the installation process on the target server. ```shell sudo /path/to/install_Solid_WGS_TN_v{version}.run ``` -------------------------------- ### FASTQ File Entry Example Source: https://help.dragen.illumina.com/product-guide/dragen-v4.4/bcl-conversion An example of a complete FASTQ file entry, illustrating the format of read identifiers and quality scores. This format can be modified by specific DRAGEN options. ```text `@SIM:1:FCX:1:2106:15337:1063:GATCTGTACGTC 1:N:0:ATCACGGATCTGTACGTCTCTGCNTCACCTCCACCGTGCAACTCATCACGCAGCTCATGCCCTTCGGCTGCCTCCTGGACTA + CCCCCGGGGGGGGGGGG#:CFFGFGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGFGGG` ``` -------------------------------- ### Run Dragen Analysis on Local Server (FASTQ, BAM, CRAM Input) Source: https://help.dragen.illumina.com/product-guide/dragen-v4.4/dragen-apps/dragen-heme-wgs-to-pipeline/quick-start This command demonstrates running a Dragen analysis on a local server with FASTQ, BAM, or CRAM files. It supports specifying multiple input folders separated by commas. ```bash --inputType \ --inputFolder /staging/input-folder-1,/staging/input-folder-2 \ --analysisFolder /staging/output-folder ``` -------------------------------- ### Get Application-Specific Help (Shell) Source: https://help.dragen.illumina.com/reference/dragen-application-manager This command retrieves detailed usage information for a specific installed application, including its provider, name, and version. It outlines the required parameters, flags, and resources needed to run the application. ```shell > dragen-app-manager help How to get application help. [Application] - Provider: Illumina - Name: SimpleApp - Version: 1.0.0 Usage: dragen-app-manager help --provider Illumina --name SimpleApp --version 1.0.0 ``` ```shell > dragen-app-manager help --provider Illumina --name SimpleApp --version 1.0.0 SimpleApp version 1.0.0 provided by Illumina This requires the parameter "A" to be set with the value "B", a Flag must be explicitly set to either true or false, and a Count with a value greater than 0. There is also an example of representing a number as a string. [Environment] --environment TZ= Description: Timezone [Settings] --setting simple= Description: A simple setting that is a filename [Parameters] --param.A Description: A required parameter with an required value of B. --param.Flag Description: A flag must be explicitly set. --param.Count Description: A number. --param.NumberString Description: A number as a string [Resources] --resource opt= Description: the /opt directory Usage: dragen-app-manager dry-run --provider Illumina --name SimpleApp --version 1.0.0 --inputDirectory input --outputDirectory output --environment TZ=EST --setting simple=config.json --resource opt=/opt --param.A B --param.Flag true --param.Count 1 --param.NumberString '"1532554234"' ``` -------------------------------- ### Make Installer Executable Source: https://help.dragen.illumina.com/product-guide/dragen-v4.4/dragen-apps/dragen-solid-wgs-tn-pipeline/installation Ensures the DRAGEN pipeline installer has the necessary execute permissions before launching. This is a crucial step for successful installation. ```shell chmod +x install_Solid_WGS_TN_v{version}.run ``` -------------------------------- ### Install Application or Resource (Shell) Source: https://help.dragen.illumina.com/reference/dragen-application-manager This command installs applications or resources into the Dragen environment. It requires a '--file' argument specifying the path to the application (.iapp) or resource (.ires) file. Resource dependencies must be installed prior to application installation. ```shell dragen-app-manager install --file ./application.iapp dragen-app-manager install --file ./resource.ires ``` -------------------------------- ### Dragen Explify Pipeline Command Line Example Source: https://help.dragen.illumina.com/product-guide/dragen-v4.4/pipeline This example demonstrates how to run the Dragen Explify Analysis Pipeline using various command-line options. It includes essential parameters like enabling the pipeline, specifying output locations, providing input sample lists, defining the test panel, and setting resource allocation. ```bash dragen \ --enable-explify=true \ --output-file-prefix \ --explify-sample-list /path/to/sample/list/tsv \ --explify-test-panel-name <"RPIP"/"UPIP"/"VSPv2"/"Custom"> \ --explify-test-panel-version \ --explify-ref-db-dir /path/to/root/db/dir \ --explify-load-db-ram=true \ --output-directory \ --intermediate-results-dir \ --explify-ncpus=1 ``` -------------------------------- ### DRAGEN Plasma Contamination Detection Command Line Example Source: https://help.dragen.illumina.com/product-guide/dragen-v4.4/mrd Example command-line invocation for running the DRAGEN plasma contamination detection module. This setup requires specifying input FASTQ files, reference directories, and output locations. ```bash /opt/dragen/$VERSION/bin/dragen # DRAGEN install path --ref-dir $REF_DIR # path to DRAGEN linear hashtable --validate-pangenome-reference=false # required --output-directory $OUTPUT --intermediate-results-dir $PATH --output-file-prefix $PREFIX # Inputs (e.g. FQ list) --fastq-list $PATH --fastq-list-sample-id $STRING ``` -------------------------------- ### Heme Pipeline Self-Test Success Output Source: https://help.dragen.illumina.com/product-guide/dragen-v4.4/dragen-apps/dragen-heme-wgs-to-pipeline/installation Example output indicating a successful Heme pipeline installation and configuration. This confirms that the pipeline is ready for use. ```text Checking system configuration...OK! Now running a test execution of the pipeline. This could take up to 15 minutes... Verifying analysis output. Successfully validated test analysis results. SUCCESS! DRAGEN Heme WGS Tumor Only Pipeline is correctly configured and ready for use. ``` -------------------------------- ### Configure Explify Analysis Pipeline with Databases Source: https://help.dragen.illumina.com/product-guide/dragen-v4.4/pipeline This configuration sets up the Explify Analysis Pipeline to use specific database files. It requires the directory where databases are stored, the test panel name, and its version. Loading databases into RAM can improve performance. ```bash # Example configuration for RPIP 6.7.0 --explify-ref-db-dir /explify-databases --explify-test-panel-name RPIP --explify-test-panel-version 6.7.0 # Recommended for databases on normal file systems --explify-load-db-ram=true # Recommended for databases on RAM disks --explify-load-db-ram=false ``` -------------------------------- ### Example Splice Variant Fusion Genes File Source: https://help.dragen.illumina.com/product-guide/dragen-v4.4/dragen-rna-pipeline/splice-variant-caller This example demonstrates the format for specifying known splice variant fusions. Lines starting with '#' are ignored. Single gene names indicate intra-genic fusions, while two gene names on a line indicate inter-genic fusions. ```plaintext # Force the below splice variant genes (intra and inter genic) to fusion caller EGFR AJM1 PHPT1 ``` -------------------------------- ### Install DRAGEN Licenses Automatically (Connected) Source: https://help.dragen.illumina.com/reference/licensing/onprem_licensing This command forces the DRAGEN server to automatically download and install all available licenses assigned to it from the Illumina License Server. It requires root privileges. For specific licenses like PipSeq or GvcfGenotyper on older DRAGEN versions, explicit calls with the -f option might be necessary. ```bash sudo dragen_lic -i auto ``` ```bash sudo dragen_lic -i auto -f PipSeq ``` ```bash sudo dragen_lic -i auto -f GvcfGenotyper ``` -------------------------------- ### Run DRAGEN Targeted Caller from FASTQ Input Source: https://help.dragen.illumina.com/product-guide/dragen-v4.4/dragen-dna-pipeline/targeted-caller This command-line example demonstrates how to run the DRAGEN Targeted Caller using FASTQ files as input. It specifies the reference genome, input FASTQ files, output directory, and enables the targeted caller. ```bash dragen \ -r /staging/human/reference/hg38_alt_aware/DRAGEN/${HASH_TABLE_VERSION} \ --fastq-file1 /staging/test/data/NA12878_R1.fastq \ --fastq-file2 /staging/test/data/NA12878_R2.fastq \ --output-directory /staging/test/output \ --output-file-prefix NA12878_dragen \ --RGID DRAGEN_RGID \ --RGSM NA12878 \ --enable-targeted=true ``` -------------------------------- ### Start Dragen Analysis on ICA Cloud using icav2 client Source: https://help.dragen.illumina.com/product-guide/dragen-v4.4/dragen-apps/dragen-heme-wgs-to-pipeline/quick-start This command initiates a Dragen analysis on the ICA cloud platform using the 'icav2' client. It requires specifying project ID, storage size, input files, and various analysis parameters like reference genome and sample IDs. ```sh icav2 projectpipelines start nextflow ${PIPELINE_ID} \ --project-id ${ANY_PROJECT_ID} \ --storage-size Large \ -o json \ --input ${ANY_SAMPLE_SHEET} \ --input ${ANY_INPUT_DIR} \ --parameters inputType:'bcl' \ --parameters referenceGenome:'hg38' \ --parameters oraCompressionEnabled:'true' \ --parameters sampleIds:'1267-Prostate-Del-R1,741-Lung-SNV-R1' \ --user-reference ${ANY_USER_REFERENCE} ``` -------------------------------- ### Example Knowns List for Splice Variants Source: https://help.dragen.illumina.com/product-guide/dragen-v4.4/dragen-rna-pipeline/splice-variant-caller This example demonstrates the format of a 'knowns' list file, used as a whitelist for splice variants. It's a tab-separated file where the first four columns specify the splice junction coordinates (contig, start, end, strand). Additional columns are present but not evaluated for filtering. ```text chr7 116771655 116774880 1 0 0 0 0 0 chr7 55019366 55155829 1 0 0 0 0 0 chrX 67686127 67694672 1 0 0 0 0 0 ``` -------------------------------- ### List Downloaded Explify Reference Databases Source: https://help.dragen.illumina.com/product-guide/dragen-v4.4/pipeline This command lists the Explify reference databases that have already been downloaded to the specified directory. The `-d` argument indicates the storage directory, and an optional `-p` argument can filter the list by a specific test panel name. ```shell ./explify-dbs.sh list -d explify-databases/ ``` -------------------------------- ### Get General Help (Shell) Source: https://help.dragen.illumina.com/reference/dragen-application-manager This command displays general help information for the Dragen Application Manager. It's the starting point for understanding the available commands and their basic usage. ```shell dragen-app-manager help ``` -------------------------------- ### Run DRAGEN with FASTQ UMI Input Source: https://help.dragen.illumina.com/product-guide/dragen-v4.4/dragen-dna-pipeline/unique-molecular-identifiers This example demonstrates running DRAGEN with UMIs sourced directly from FASTQ files. It uses the '--umi-source=fastq' and '--umi-fastq' options to specify the UMI FASTQ file. The UMI library type can be adjusted to 'random-simplex' or 'random-duplex'. ```bash dragen \ -r \ -1 \ -2 \ --umi-source=fastq \ --umi-fastq \ --output-dir \ --output-file-prefix \ --enable-map-align true \ --enable-sort true \ --umi-library-type nonrandom-duplex \ --umi-metrics-interval-file [valid target BED file] ``` -------------------------------- ### Download a Specific Explify Reference Database Source: https://help.dragen.illumina.com/product-guide/dragen-v4.4/pipeline This command downloads a specified Explify reference database using the `explify-dbs.sh` script. It requires the database directory (`-d`), test panel name (`-p`), and version (`-v`). The `-n` argument allows specifying the number of CPUs for faster downloading. ```shell ./explify-dbs.sh download -d explify-databases/ -p UPIP -v 8.8.0 -n 20 ``` -------------------------------- ### DRAGEN License Server Healthcheck Response Source: https://help.dragen.illumina.com/reference/licensing/onprem_licensing This is an example of a successful response from the DRAGEN License Server's healthcheck endpoint. A 200 status code and a JSON body containing the server version indicate that the server is reachable and operational. ```json {"version":""} ``` -------------------------------- ### Run DRAGEN 16S Analysis with Paired-End Reads and Pre-built Database Source: https://help.dragen.illumina.com/product-guide/dragen-v4.4/dragen-16s-pipeline This example demonstrates how to run the DRAGEN 16S pipeline using paired-end FASTQ files and a pre-built reference database. It specifies essential inputs like output prefixes and directories, FASTQ files, and the database location, along with the number of threads for processing. ```bash /opt/dragen/$VERSION/bin/dragen --enable-16s true --output-file-prefix analysis1 --output-directory /path/to/output/ --16s-fastq1 /path/to/input/sampleA_S1_L001_R1_001.fastq.gz --16s-fastq2 /path/to/input/sampleA_S1_L001_R2_001.fastq.gz --16s-db-dir /path/to/databases/Refseq-RDP-v1/1.0.1/ --num-threads 20 ``` -------------------------------- ### List Applications and Resources Source: https://help.dragen.illumina.com/reference/dragen-application-manager Provides a list of all installed applications and available resources. The '--detailed' flag offers more comprehensive information. Output can be parsed with 'jq'. ```shell dragen-app-manager list dragen-app-manager list | jq dragen-app-manager list --detailed | jq ``` -------------------------------- ### Execute DRAGEN Batch Task Source: https://help.dragen.illumina.com/reference/dragen-multi-cloud/azure-batch/run-azure-modes Bash command to execute a DRAGEN task within an Azure Batch job. It handles file extraction, DRAGEN execution with specified parameters, and output directory setup. Assumes DRAGEN is installed and tarball is available. ```bash /bin/bash -c \ "mkdir ; \ tar xzvf dragen.tar -C ; \ /opt/edico/bin/dragen --partial-reconfig HMM --ignore-version-check true; \ /opt/edico/bin/dragen -f -r \ -1 \ -2 \ --RGID \ --RGSM \ --enable-bam-indexing true \ --enable-map-align-output true \ --enable-sort true \ --output-file-prefix dragen-batch \ --enable-map-align true \ --output-format BAM \ --output-directory \ --enable-variant-caller true \ --lic-server " ```