### Example of a read starting with an adapter

Source: https://cutadapt.readthedocs.io/en/stable/guide.html

Demonstrates that a read consisting entirely of an adapter and subsequent sequence is trimmed to an empty read.

```text
ADAPTERsomething
```

--------------------------------

### Set Up Virtual Environment and Install Dependencies

Source: https://cutadapt.readthedocs.io/en/stable/_sources/develop.rst.txt

Create a virtual environment, activate it, and install necessary development tools like Cython, pytest, tox, and pre-commit. Finally, install Cutadapt in editable mode.

```bash
cd cutadapt
virtualenv .venv
source .venv/bin/activate
pip install Cython pytest tox pre-commit
pre-commit install
pip install -e .
```

--------------------------------

### Install Cutadapt on FreeBSD

Source: https://cutadapt.readthedocs.io/en/stable/_sources/installation.rst.txt

Install the binary package for Cutadapt on FreeBSD.

```bash
pkg install py39-cutadapt
```

--------------------------------

### Install Cutadapt on Windows

Source: https://cutadapt.readthedocs.io/en/stable/installation.html

Install Cutadapt on Windows using pip after installing Python and C++ build tools.

```bash
py -m pip install cutadapt
```

```bash
py -m cutadapt --version
```

--------------------------------

### Install Cutadapt via pip in Virtual Environment

Source: https://cutadapt.readthedocs.io/en/stable/installation.html

Set up a virtual environment and install Cutadapt using pip.

```bash
sudo apt install python3-virtualenv
```

```bash
virtualenv cutadapt-venv
cutadapt-venv/bin/pip --upgrade pip
cutadapt-venv/bin/pip install cutadapt
```

```bash
cutadapt-venv/bin/cutadapt --version
```

```bash
source cutadapt-venv/bin/activate
cutadapt --version
```

--------------------------------

### Install development environment

Source: https://cutadapt.readthedocs.io/en/stable/develop.html

Commands to clone the repository, set up a virtual environment, and install necessary development tools.

```bash
git clone https://github.com/marcelm/cutadapt.git  # or clone your own fork
cd cutadapt
virtualenv .venv
source .venv/bin/activate
pip install Cython pytest tox pre-commit
pre-commit install
pip install -e .
```

--------------------------------

### Install Cutadapt via pkgin

Source: https://cutadapt.readthedocs.io/en/stable/_sources/installation.rst.txt

Use the pkgin package manager to install Cutadapt on supported systems.

```bash
pkgin install py311-cutadapt
```

--------------------------------

### Install Cutadapt Development Version

Source: https://cutadapt.readthedocs.io/en/stable/installation.html

Commands to set up a virtual environment and install the latest Cutadapt source code from GitHub.

```bash
python3 -m venv ~/cutadapt-venv
~/cutadapt-venv/bin/python3 -m pip install --upgrade pip
~/cutadapt-venv/bin/pip install git+https://github.com/marcelm/cutadapt.git
```

--------------------------------

### Install Cutadapt via FreeBSD and pkgsrc

Source: https://cutadapt.readthedocs.io/en/stable/installation.html

Install binary packages for Cutadapt on FreeBSD or systems using pkgsrc.

```bash
pkg install py39-cutadapt
```

```bash
pkgin install py311-cutadapt
```

--------------------------------

### Example Trimming Output

Source: https://cutadapt.readthedocs.io/en/stable/guide.html

The resulting trimmed reads after applying the linked adapter command to the example input.

```text
mysequence
mysequence
myseque
anotherreadSECOND
```

--------------------------------

### Example of Linked Adapter Trimming

Source: https://cutadapt.readthedocs.io/en/stable/_sources/guide.rst.txt

Demonstrates trimming with linked adapters. The 5' adapter is required, and if missing, the read is not trimmed, as shown in the last example read.

```bash
cutadapt -a ^FIRST...SECOND -o output.fastq input.fastq
```

--------------------------------

### Install Cutadapt for Shared Cluster Use

Source: https://cutadapt.readthedocs.io/en/stable/installation.html

Commands to create a virtual environment and link the Cutadapt executable for a shared module installation.

```bash
BASE=/software/cutadapt-3.1
virtualenv $BASE/venv
$BASE/venv/bin/pip install cutadapt==3.1
mkdir $BASE/bin
cd $BASE/bin
ln -s ../venv/bin/cutadapt
```

--------------------------------

### Identify incomplete adapter warnings

Source: https://cutadapt.readthedocs.io/en/stable/guide.html

Example of the warning output generated by Cutadapt when an adapter sequence appears to be missing a base at the start.

```text
WARNING:
    One or more of your adapter sequences may be incomplete.
    Please see the detailed output above.
```

```text
Bases preceding removed adapters:
  A: 95.5%
  C: 1.0%
  G: 1.6%
  T: 1.6%
  none/other: 0.3%
WARNING:
    The adapter is preceded by "A" extremely often.
    The provided adapter sequence may be incomplete.
    To fix the problem, add "A" to the beginning of the adapter sequence.
```

--------------------------------

### Install Cutadapt via pipx

Source: https://cutadapt.readthedocs.io/en/stable/installation.html

Install Cutadapt using pipx on supported Linux distributions.

```bash
sudo apt install pipx python3-venv
pipx install cutadapt
cutadapt --version
```

--------------------------------

### Verify Cutadapt Installation

Source: https://cutadapt.readthedocs.io/en/stable/installation.html

Command to check the installed version of Cutadapt.

```bash
~/cutadapt-venv/bin/cutadapt --version
```

--------------------------------

### Install Cutadapt via Conda

Source: https://cutadapt.readthedocs.io/en/stable/installation.html

Create a new environment and install Cutadapt, with an optional variant for Apple Silicon.

```bash
conda create -n cutadapt cutadapt
```

```bash
CONDA_SUBDIR=osx-64 conda create -n cutadapt cutadapt
```

--------------------------------

### Verify Cutadapt installation

Source: https://cutadapt.readthedocs.io/en/stable/develop.html

Commands to check the installed version of Cutadapt.

```bash
cutadapt --version
```

```bash
venv/bin/cutadapt --version
```

--------------------------------

### Adapter Dimer Alignment Examples

Source: https://cutadapt.readthedocs.io/en/stable/algorithms.html

Examples showing how the updated algorithm handles multiple adapter occurrences in reads compared to the previous version.

```text
@SRR452441.2151945
                                         AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC  Previous alignment
                                         ||||||||||||||||||||||||||||||||||
-GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCACACGAGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCACACGAATCTCGTATGCCGTCTTCT
X|||||||||||||||||||||||||||||||||
AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC  New alignment
```

```text
@SRR452441.2157038
                                AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC  Previous alignment
                                ||||||||||||||||||||||||||||||||||
-GATCGGAAGAGCACACGTCTGAACTCCAGTCAGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCACACGAATCTCGTATGCCGTCTTCTGCTTGAAAA
X||||||||||||||||||||||||||||||||X
AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC  New alignment
```

--------------------------------

### Install Cutadapt via System Package Manager

Source: https://cutadapt.readthedocs.io/en/stable/installation.html

Install Cutadapt using native Debian/Ubuntu package managers.

```bash
sudo apt install cutadapt
```

```bash
sudo apt install python3-cutadapt
```

--------------------------------

### Configure Adapter Search Parameters

Source: https://cutadapt.readthedocs.io/en/stable/_sources/guide.rst.txt

Examples of setting search parameters for adapters using the file notation or within a FASTA file.

```bash
cutadapt -a "file:adapters.fa;min_overlap=5;noindels"
```

```text
>adapter1
^ACGT;min_overlap=3
>adapter2
AACCGGT;noindels
```

--------------------------------

### Example of default adapter reporting

Source: https://cutadapt.readthedocs.io/en/stable/_sources/guide.rst.txt

Example output showing statistics for an adapter identified by its number. The report includes the adapter sequence, length, and trim count.

```text
=== Adapter 1 ===

Sequence: AACCGGTT; Length 8; Trimmed: 5 times.
```

--------------------------------

### Activate and Verify Conda Installation

Source: https://cutadapt.readthedocs.io/en/stable/installation.html

Activate the environment and verify the installation by checking the version.

```bash
conda activate cutadapt
```

```bash
cutadapt --version
```

--------------------------------

### Example of named adapter reporting

Source: https://cutadapt.readthedocs.io/en/stable/_sources/guide.rst.txt

Example output showing statistics for a named adapter. The report includes the adapter name, sequence, length, and trim count.

```text
=== Adapter 'My_Adapter' ===

Sequence: TTAGACATATCTCCGTCG; Length 18; Trimmed: 5 times.
```

--------------------------------

### Example Input Reads

Source: https://cutadapt.readthedocs.io/en/stable/guide.html

Sample input reads demonstrating sequences with and without the specified 5' and 3' adapters.

```text
FIRSTmysequenceSECONDextrabases
FIRSTmysequenceSEC
FIRSTmyseque
anotherreadSECOND
```

--------------------------------

### Example FASTQ header structure

Source: https://cutadapt.readthedocs.io/en/stable/guide.html

Shows the components of a standard FASTQ header line for reference in renaming templates.

```text
@read1234 value=17
```

--------------------------------

### Example FASTA input read

Source: https://cutadapt.readthedocs.io/en/stable/guide.html

A sample FASTA record used to demonstrate the renaming functionality.

```text
>myread extra info
ACGTAAAATTTTCCCC
```

--------------------------------

### Anchored 5' Adapter Trimming Example

Source: https://cutadapt.readthedocs.io/en/stable/_sources/guide.rst.txt

Shows how to trim anchored 5' adapters using the -g ^ADAPTER option. This method requires the adapter to be at the very beginning of the read.

```bash
cutadapt -g ^ADAPTER reads.fastq -o reads.trimmed.fastq
```

--------------------------------

### Properly Paired FASTQ Headers

Source: https://cutadapt.readthedocs.io/en/stable/reference.html

Example of FASTQ headers that Cutadapt considers properly paired.

```text
@my_read/1 a comment

```

```text
@my_read/2 another comment

```

--------------------------------

### Minimal Report Output Example

Source: https://cutadapt.readthedocs.io/en/stable/guide.html

This example shows the tab-separated output format of the minimal report, including headers and a data row. The last three fields are omitted for single-end data.

```bash
$ cutadapt --report=minimal -a ... -m 20 -q 10 -o ... -p ... in.[12].fastq.gz
status in_reads in_bp     too_short too_long too_many_n out_reads w/adapters qualtrim_bp out_bp w/adapters2 qualtrim2_bp out2_bp
OK     1000000  202000000 24827     0        0          975173    28968      1674222     97441426 0 0 98492473

```

--------------------------------

### Multiple adapter occurrence trimming examples

Source: https://cutadapt.readthedocs.io/en/stable/guide.html

Examples showing how Cutadapt trims reads when multiple copies of the same adapter are present.

```text
cccccADAPTERgggggADAPTERttttt
```

```text
ccccc
```

```text
gggggADAPTERttttt
```

--------------------------------

### Identifying incomplete adapter sequences

Source: https://cutadapt.readthedocs.io/en/stable/_sources/guide.rst.txt

Example output indicating that adapter sequences may be incomplete based on base composition analysis.

```text
WARNING:
    One or more of your adapter sequences may be incomplete.
    Please see the detailed output above.
```

```text
Bases preceding removed adapters:
  A: 95.5%
  C: 1.0%
  G: 1.6%
  T: 1.6%
  none/other: 0.3%
WARNING:
```

--------------------------------

### Non-Internal 5' Adapter Trimming Example

Source: https://cutadapt.readthedocs.io/en/stable/_sources/guide.rst.txt

Demonstrates trimming non-internal 5' adapters with the -g XADAPTER option. This allows the adapter to be preceded by some bases.

```bash
cutadapt -g XADAPTER reads.fastq -o reads.trimmed.fastq
```

--------------------------------

### Per-adapter statistics example

Source: https://cutadapt.readthedocs.io/en/stable/_sources/guide.rst.txt

Cutadapt provides detailed statistics for each adapter found, including its sequence, length, and the number of times it was trimmed.

```text
Sequence: 'ACGTACGTACGTTAGCTAGC'; Length: 20; Trimmed: 2402 times.
```

--------------------------------

### Resulting sequences after 3' adapter trimming

Source: https://cutadapt.readthedocs.io/en/stable/guide.html

Shows the output after applying the -a ADAPTER option to the example reads.

```text
mysequen
mysequence
mysequence
mysequence
```

--------------------------------

### Clone Cutadapt Repository

Source: https://cutadapt.readthedocs.io/en/stable/_sources/develop.rst.txt

Clone the Cutadapt repository from GitHub to start development. This is the initial step for setting up your local development environment.

```bash
git clone https://github.com/marcelm/cutadapt.git  # or clone your own fork
```

--------------------------------

### Adapter Error Tolerance Configuration

Source: https://cutadapt.readthedocs.io/en/stable/_sources/guide.rst.txt

Examples of setting error tolerance using command line options or adapter-specific parameters.

```bash
-a "ADAPTER;max_error_rate=0.15"
-a "ADAPTER;e=0.15"
```

```bash
-a "ADAPTER;e=1"
-a "ADAPTER;max_errors=2.5"
```

--------------------------------

### Cutadapt JSON Report Example

Source: https://cutadapt.readthedocs.io/en/stable/_sources/reference.rst.txt

A sample JSON output generated when using the --json flag, containing run metadata, read counts, and adapter trimming statistics.

```json
{
  "tag": "Cutadapt report",
  "schema_version": [0, 3],
  "cutadapt_version": "4.5",
  "python_version": "3.8.10",
  "command_line_arguments": [
    "--json=out.cutadapt.json", "--poly-a", "-m", "20", "-a", "AACCGGTTACGTTGCA",
    "-q", "20", "--discard-trimmed", "-o", "out.fastq.gz", "reads.fastq"],
  "cores": 1,
  "input": {
    "path1": "reads.fastq",
    "path2": null,
    "paired": false,
    "interleaved": null
  },
  "read_counts": {
    "input": 100000,
    "filtered": {
      "too_short": 251,
      "too_long": null,
      "too_many_n": null,
      "too_many_expected_errors": null,
      "casava_filtered": null,
      "discard_trimmed": 2061,
      "discard_untrimmed": null
    },
    "output": 97688,
    "reverse_complemented": null,
    "read1_with_adapter": 2254,
    "read2_with_adapter": null
  },
  "basepair_counts": {
    "input": 10100000,
    "input_read1": 10100000,
    "input_read2": null,
    "quality_trimmed": 842048,
    "quality_trimmed_read1": 842048,
    "quality_trimmed_read2": null,
    "poly_a_trimmed": 1028,
    "poly_a_trimmed_read1": 1028,
    "poly_a_trimmed_read2": null,
    "output": 9037053,
    "output_read1": 9037053,
    "output_read2": null
  },
  "adapters_read1": [
    {
      "name": "1",
      "total_matches": 2254,
      "on_reverse_complement": null,
      "linked": false,
      "five_prime_end": null,
      "three_prime_end": {
        "type": "regular_three_prime",
        "sequence": "AACCGGTTACGTTGCA",
        "error_rate": 0.1,
        "indels": true,
        "error_lengths": [6],
        "matches": 2254,
        "adjacent_bases": {
          "A": 473,
          "C": 1240,
          "G": 328,
          "T": 207,
          "": 6
        },
        "dominant_adjacent_base": null,
        "trimmed_lengths": [
          {"len": 3, "expect": 1562.5, "counts": [1220]},
          {"len": 4, "expect": 390.6, "counts": [319]},
          {"len": 5, "expect": 97.7, "counts": [30]},
          {"len": 6, "expect": 24.4, "counts": [4]},
          {"len": 7, "expect": 24.4, "counts": [5]},
          {"len": 8, "expect": 24.4, "counts": [7]},
          {"len": 9, "expect": 24.4, "counts": [4]},
          {"len": 10, "expect": 24.4, "counts": [7]},
          {"len": 11, "expect": 24.4, "counts": [7]},
          {"len": 12, "expect": 24.4, "counts": [6]},
          {"len": 13, "expect": 24.4, "counts": [8, 2]},
          {"len": 14, "expect": 24.4, "counts": [1, 1]},
          {"len": 15, "expect": 24.4, "counts": [2, 0]},
          {"len": 16, "expect": 24.4, "counts": [3, 1]},
        ]
      }
    }
  ],
  "adapters_read2": null,
  "poly_a_trimmed_read1": [
    {"len": 23, "count": 10}
```

--------------------------------

### 5' Adapter Trimming Example

Source: https://cutadapt.readthedocs.io/en/stable/_sources/guide.rst.txt

Illustrates 5' adapter trimming with Cutadapt. Use the -g option to specify the adapter sequence. The adapter and any preceding sequence are removed, which can also lead to empty reads.

```bash
cutadapt -g ADAPTER reads.fastq -o reads.trimmed.fastq
```

--------------------------------

### Configure Bioconda Channels

Source: https://cutadapt.readthedocs.io/en/stable/installation.html

Set up the required channels for Bioconda before installing packages.

```bash
conda config --add channels bioconda
conda config --add channels conda-forge
conda config --set channel_priority strict
```

--------------------------------

### Example read sequences for 3' adapter trimming

Source: https://cutadapt.readthedocs.io/en/stable/guide.html

Illustrates how a fragment of interest combined with an adapter appears in reads of varying lengths.

```text
mysequen
mysequenceADAP
mysequenceADAPTER
mysequenceADAPTERsomethingelse
```

--------------------------------

### Configure Lmod Module for Cutadapt

Source: https://cutadapt.readthedocs.io/en/stable/installation.html

Example Lmod configuration file content to add the Cutadapt binary directory to the user PATH.

```lua
conflict("cutadapt")
whatis("adapter trimming tool")
prepend_path("PATH", "/software/cutadapt-3.1/bin")
```

--------------------------------

### Info File Format: Adapter Match Found

Source: https://cutadapt.readthedocs.io/en/stable/_sources/reference.rst.txt

This is an example of a row in the Cutadapt info file when an adapter match is found. It includes read name, errors, coordinates, sequences before, during, and after the match, adapter name, and quality values.

```text
read_name	2	15	50	sequence_left	adapter_sequence	sequence_right	adapter_name	qual_left	qual_adapter	qual_right	1
```

--------------------------------

### Run Cutadapt Version Check

Source: https://cutadapt.readthedocs.io/en/stable/_sources/develop.rst.txt

Verify that Cutadapt has been installed correctly by checking its version. This command can be run after setting up the development environment.

```bash
cutadapt --version
```

--------------------------------

### Minimal report output example

Source: https://cutadapt.readthedocs.io/en/stable/_sources/guide.rst.txt

Generate a one-line summary report using --report=minimal. This output is a tab-separated table useful for quick overviews.

```bash
$ cutadapt --report=minimal -a ... -m 20 -q 10 -o ... -p ... in.[12].fastq.gz
status in_reads in_bp     too_short too_long too_many_n out_reads w/adapters qualtrim_bp out_bp w/adapters2 qualtrim2_bp out2_bp
OK     1000000  202000000 24827     0        0          975173    28968      1674222     97441426 0 0 98492473
```

--------------------------------

### Info File Format: No Adapter Match Found

Source: https://cutadapt.readthedocs.io/en/stable/_sources/reference.rst.txt

This is an example of a row in the Cutadapt info file when no adapter match is found. It includes the read name, -1 to indicate no match, the full read sequence, and quality values.

```text
read_name	-1	read_sequence	quality_values
```

--------------------------------

### 3' Adapter Trimming Example

Source: https://cutadapt.readthedocs.io/en/stable/_sources/guide.rst.txt

Demonstrates how Cutadapt trims 3' adapters. Use the -a option to specify the adapter sequence. Cutadapt removes the adapter and any subsequent sequence, potentially resulting in empty reads.

```bash
cutadapt -a ADAPTER reads.fastq -o reads.trimmed.fastq
```

--------------------------------

### Show help message

Source: https://cutadapt.readthedocs.io/en/stable/_sources/reference.rst.txt

Display the help message to see all available command-line options.

```bash
cutadapt -h
```

--------------------------------

### Check FASTQ File Formatting

Source: https://cutadapt.readthedocs.io/en/stable/recipes.html

Verify the formatting of a FASTQ file by running Cutadapt with the output redirected to `/dev/null`. Any formatting issues will be reported.

```bash
cutadapt -o /dev/null input.fastq

```

--------------------------------

### Trim Forward and Reverse Primers (Paired-End)

Source: https://cutadapt.readthedocs.io/en/stable/_sources/recipes.rst.txt

This configuration is for paired-end reads where R1 starts with the forward primer and R2 starts with the reverse primer, and reads are not expected to extend into the other primer.

```bash
-g ^FWDPRIMER -G ^REVPRIMER --discard-untrimmed
```

--------------------------------

### Remove Primers for Short Reads

Source: https://cutadapt.readthedocs.io/en/stable/recipes.html

Use these options to remove forward and reverse primers when reads are short and do not extend into the other primer. `--discard-untrimmed` removes read pairs where R1 does not start with FWDPRIMER or R2 does not start with REVPRIMER.

```bash
-g ^FWDPRIMER -G ^REVPRIMER --discard-untrimmed

```

--------------------------------

### Define barcodes in a FASTA file

Source: https://cutadapt.readthedocs.io/en/stable/_sources/guide.rst.txt

Example format for a FASTA file containing barcode sequences.

```fasta
>barcode01
TTAAGGCC
>barcode02
TAGCTAGC
>barcode03
ATGATGAT
```

--------------------------------

### Update read length tag

Source: https://cutadapt.readthedocs.io/en/stable/_sources/guide.rst.txt

Example of updating a length tag in the read header after trimming.

```text
>read1 length=17
ACGTACGTACAAAAAAA
```

```text
>read1 length=10
ACGTACGTAC
```

--------------------------------

### Example of Cutadapt report output

Source: https://cutadapt.readthedocs.io/en/stable/_sources/guide.rst.txt

The report displays the number of reads or read pairs that were reverse-complemented.

```text
Total reads processed:  60
Reads with adapters:    50 (83.3%)
Reverse-complemented:   20 (33.3%)
```

--------------------------------

### Anchor 5' adapters from a FASTA file

Source: https://cutadapt.readthedocs.io/en/stable/_sources/guide.rst.txt

Anchor all 5' adapters read from a FASTA file to the beginning of the read using the '^file:' syntax. Requires Cutadapt version 4.1 or later.

```bash
cutadapt -g ^file:adapters.fasta -o output.fastq input.fastq
```

--------------------------------

### Improperly Paired FASTQ Headers

Source: https://cutadapt.readthedocs.io/en/stable/reference.html

Example of FASTQ headers that are not considered properly paired due to the suffix.

```text
@my_read/1;1

```

```text
@my_read/2;1

```

--------------------------------

### Checking Paired-End FASTQ File Pairing

Source: https://cutadapt.readthedocs.io/en/stable/_sources/recipes.rst.txt

Employ Cutadapt with '-o /dev/null -p /dev/null' to verify that paired-end FASTQ files are correctly paired and that read IDs match. Problems with individual files or pairing will be reported.

```bash
cutadapt -o /dev/null -p /dev/null input.R1.fastq input.R2.fastq
```

--------------------------------

### Rename reads with prefix

Source: https://cutadapt.readthedocs.io/en/stable/_sources/guide.rst.txt

Example of using the --rename option to move a prefix from the sequence into the read ID.

```text
>myread this is R1
ACGTAAAATTTT

>myread this is R2
GGGGCCCC
```

```text
>myread_ACGT this is R1
AAAATTTT

>myread_ACGT this is R2
GGGGCCCC
```

--------------------------------

### Alignment Comparison Example 1

Source: https://cutadapt.readthedocs.io/en/stable/algorithms.html

Comparison of previous and tuned alignment results for a specific read and adapter sequence.

```text
CCAGTCCTTTCCTGAGAGT   Read
||||||||   ||
CCAGTCCT---CT         5' adapter
```

```text
CCAGTCCTTTCCTGAGAGT   Read
||||||||X|
CCAGTCCTCT            5' adapter
```

--------------------------------

### Using Linked Adapters with Search Parameters

Source: https://cutadapt.readthedocs.io/en/stable/_sources/guide.rst.txt

Provide search parameters for linked adapters by setting them for each constituent adapter separately, separated by semicolons.

```bash
-g "ADAPTER1;min_overlap=5...ADAPTER2;min_overlap=6"
```

--------------------------------

### Example of trimmed_lengths structure

Source: https://cutadapt.readthedocs.io/en/stable/reference.html

Shows the structure of the trimmed_lengths list containing length, expected counts, and error-specific match counts.

```json
"trimmed_lengths": [
  {"len": 4, "expect": 390.6, "counts": [319]},
  {"len": 5, "expect": 97.7, "counts": [30]},
  {"len": 6, "expect": 24.4, "counts": [4]},
  {"len": 7, "expect": 24.4, "counts": [5]},
  {"len": 15, "expect": 24.4, "counts": [2, 1]},
]
```

--------------------------------

### Get Adapter Match Count

Source: https://cutadapt.readthedocs.io/en/stable/recipes.html

Use `jq` to retrieve the total number of times the first adapter was matched in the reads.

```bash
jq '.adapters_read1[0].total_matches' mysample.cutadapt.json
```

--------------------------------

### Run Cutadapt Using Virtual Environment Path

Source: https://cutadapt.readthedocs.io/en/stable/_sources/develop.rst.txt

Execute the Cutadapt binary directly from its virtual environment path. This is an alternative to running it after activating the environment.

```bash
venv/bin/cutadapt --version
```

--------------------------------

### Create patterns.txt for mmv

Source: https://cutadapt.readthedocs.io/en/stable/_sources/guide.rst.txt

Define adapter-to-sample name mappings in patterns.txt for batch file renaming with mmv.

```bash
fwdindex1-revindex1.[12].fastq.gz sampleA.#1.fastq.gz
fwdindex1-revindex2.[12].fastq.gz sampleB.#1.fastq.gz
fwdindex1-revindex3.[12].fastq.gz sampleC.#1.fastq.gz
fwdindex2-revindex1.[12].fastq.gz sampleD.#1.fastq.gz
fwdindex2-revindex2.[12].fastq.gz sampleE.#1.fastq.gz
...
```

--------------------------------

### Adapter Alignment Comparison

Source: https://cutadapt.readthedocs.io/en/stable/_sources/algorithms.rst.txt

Visual comparison of read trimming between the previous and updated alignment algorithms using SRR452441 dataset examples.

```text
@SRR452441.2151945
                                             AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC  Previous alignment
                                             ||||||||||||||||||||||||||||||||||
    -GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCACACGAGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCACACGAATCTCGTATGCCGTCTTCT
    X|||||||||||||||||||||||||||||||||
    AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC  New alignment
```

```text
@SRR452441.2157038
                                    AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC  Previous alignment
                                    ||||||||||||||||||||||||||||||||||
    -GATCGGAAGAGCACACGTCTGAACTCCAGTCAGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCACACGAATCTCGTATGCCGTCTTCTGCTTGAAAA
    X||||||||||||||||||||||||||||||||X
    AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC  New alignment
```

--------------------------------

### Release management

Source: https://cutadapt.readthedocs.io/en/stable/develop.html

Commands to tag a new release and push it to the repository.

```bash
git tag v0.1
```

```bash
git push --tags
```

--------------------------------

### Checking FASTQ File Formatting

Source: https://cutadapt.readthedocs.io/en/stable/_sources/recipes.rst.txt

Use Cutadapt with '-o /dev/null' to validate the formatting of a single FASTQ file. Any detected issues will be reported.

```bash
cutadapt -o /dev/null input.fastq
```

--------------------------------

### View Allowed Errors in Cutadapt Report

Source: https://cutadapt.readthedocs.io/en/stable/_sources/guide.rst.txt

Example output showing how Cutadapt reports the number of allowed errors based on match length.

```text
Sequence: 'SOMEADAPTER'; Length: 11; Trimmed: 2 times.

No. of allowed errors:
0-9 bp: 0; 10-11 bp: 1
```

--------------------------------

### Trim 3' Adapter (Basic)

Source: https://cutadapt.readthedocs.io/en/stable/guide.html

Use this command to trim a 3' adapter sequence from input FASTQ files. Replace AACCGGTT with your adapter sequence.

```bash
cutadapt -a AACCGGTT -o output.fastq input.fastq.gz

```

--------------------------------

### Trim 3' Adapter (Compressed Files)

Source: https://cutadapt.readthedocs.io/en/stable/guide.html

This command trims a 3' adapter sequence from compressed FASTQ input and writes to a compressed output file. Replace AACCGGTT with your adapter sequence.

```bash
cutadapt -a AACCGGTT -o output.fastq.gz input.fastq.gz

```

--------------------------------

### Run Tests with Tox

Source: https://cutadapt.readthedocs.io/en/stable/_sources/develop.rst.txt

Run tests across multiple Python versions using tox. This requires having binaries for all tested Python versions installed on your system.

```bash
tox
```

--------------------------------

### Trim with Linked Adapters (5' anchored)

Source: https://cutadapt.readthedocs.io/en/stable/guide.html

Use this command to trim a sequence with a 5' adapter (anchored) and a 3' adapter. The 5' adapter is required.

```bash
cutadapt -a ^ADAPTER1...ADAPTER2 -o out.fastq.gz in.fastq.gz
```