### Compare Pooled WGS Samples

Source: https://docs.crispresso.com/latest/pooledwgscompare/examples.html

Compares two CRISPRessoPooled output directories using either a local Bioconda installation or a Docker container.

```bash
CRISPRessoPooledWGSCompare CRISPRessoPooled_on_AMPLICONS_AND_GENOME_SRR1046762/ CRISPRessoPooled_on_AMPLICONS_AND_GENOME_SRR1046787/ -n1 SRR1046762 -n2 SRR1046787 -n AMPLICONS_AND_GENOME_SRR1046762_VS_SRR1046787
```

```bash
docker run -v ${PWD}:/DATA -w /DATA -i pinellolab/crispresso2 CRISPRessoPooledWGSCompare CRISPRessoPooled_on_AMPLICONS_AND_GENOME_SRR1046762/ CRISPRessoPooled_on_AMPLICONS_AND_GENOME_SRR1046787/ -n1 SRR1046762 -n2 SRR1046787 -n AMPLICONS_AND_GENOME_SRR1046762_VS_SRR1046787
```

--------------------------------

### Run CRISPRessoAggregate with Bioconda

Source: https://docs.crispresso.com/latest/aggregate/examples.html

Use this command to aggregate CRISPResso runs when installed via Bioconda. Ensure you have Bioconda set up and CRISPResso installed.

```bash
CRISPRessoAggregate --name "VEGFA" --prefix CRISPRessoRuns/VEGFA/
```

--------------------------------

### CRISPRessoBatch Parameters

Source: https://docs.crispresso.com/latest/batch/tool.html

CRISPRessoBatch enables users to analyze multiple input files by uploading a batch file. It supports parallel analysis and comparison between samples with identical amplicon and guide sequences.

```APIDOC
## CRISPRessoBatch Parameters

CRISPRessoBatch allows users to analyze multiple input files and other command line arguments by uploading a Batch file, and then to run CRISPResso2 analysis on each file in parallel. Samples for which the amplicon and guide sequences are the same will be compared between batches, producing useful summary tables and comparison plots.

### Parameter List

- `--amplicon_seq` (string): Sequence of the amplicon.
- `--amplicon_name` (string): Name of the amplicon.
- `--amplicon_min_alignment_score` (integer): Minimum alignment score for the amplicon.
- `--default_min_aln_score` (integer): Default minimum alignment score.
- `--expand_ambiguous_alignments` (boolean): Expand ambiguous alignments.
- `--assign_ambiguous_alignments_to_first_reference` (boolean): Assign ambiguous alignments to the first reference.
- `--guide_seq` (string): Sequence of the guide RNA.
- `--guide_name` (string): Name of the guide RNA.
- `--flexiguide_seq` (string): Sequence of the flexible guide.
- `--flexiguide_homology` (integer): Homology length for the flexible guide.
- `--flexiguide_name` (string): Name of the flexible guide.
- `--flexiguide_gap_open_penalty` (integer): Gap open penalty for the flexible guide.
- `--flexiguide_gap_extend_penalty` (integer): Gap extend penalty for the flexible guide.
- `--discard_guide_positions_overhanging_amplicon_edge` (boolean): Discard guide positions overhanging the amplicon edge.
- `--expected_hdr_amplicon_seq` (string): Expected HDR amplicon sequence.
- `--coding_seq` (string): Coding sequence.
- `--config_file` (string): Path to a configuration file.
- `--min_average_read_quality` (float): Minimum average read quality.
- `--min_single_bp_quality` (float): Minimum single base pair quality.
- `--min_bp_quality_or_N` (float): Minimum base pair quality or N.
- `--file_prefix` (string): Prefix for output files.
- `--name` (string): Name for the analysis.
- `--display_name` (string): Display name for the analysis.
- `--suppress_amplicon_name_truncation` (boolean): Suppress amplicon name truncation.
- `--output_folder` (string): Folder for output files.
- `--verbosity` (integer): Verbosity level for output.
- `--split_interleaved_input` (boolean): Split interleaved input files.
- `--trim_sequences` (boolean): Trim sequences.
- `--trimmomatic_command` (string): Path to Trimmomatic executable.
- `--trimmomatic_options_string` (string): String of options for Trimmomatic.
- `--flash_command` (string): Path to FLASH executable.
- `--fastp_command` (string): Path to fastp executable.
- `--fastp_options_string` (string): String of options for fastp.
- `--min_paired_end_reads_overlap` (integer): Minimum overlap for paired-end reads.
- `--max_paired_end_reads_overlap` (integer): Maximum overlap for paired-end reads.
- `--stringent_flash_merging` (boolean): Use stringent FLASH merging.
- `--quantification_window_size` (integer): Size of the quantification window.
- `--quantification_window_center` (string): Center of the quantification window.
- `--exclude_bp_from_left` (integer): Number of base pairs to exclude from the left.
- `--exclude_bp_from_right` (integer): Number of base pairs to exclude from the right.
- `--use_legacy_insertion_quantification` (boolean): Use legacy insertion quantification.
- `--ignore_substitutions` (boolean): Ignore substitutions.
- `--ignore_insertions` (boolean): Ignore insertions.
- `--ignore_deletions` (boolean): Ignore deletions.
- `--discard_indel_reads` (boolean): Discard reads with indels.
- `--needleman_wunsch_gap_open` (integer): Gap open penalty for Needleman-Wunsch.
- `--needleman_wunsch_gap_extend` (integer): Gap extend penalty for Needleman-Wunsch.
- `--needleman_wunsch_gap_incentive` (integer): Gap incentive for Needleman-Wunsch.
- `--needleman_wunsch_aln_matrix_loc` (string): Location of the alignment matrix for Needleman-Wunsch.
- `--plot_histogram_outliers` (boolean): Plot histogram outliers.
- `--plot_window_size` (integer): Size of the plotting window.
- `--min_frequency_alleles_around_cut_to_plot` (float): Minimum frequency of alleles around the cut to plot.
- `--expand_allele_plots_by_quantification` (boolean): Expand allele plots by quantification.
- `--allele_plot_pcts_only_for_assigned_reference` (boolean): Show allele plot percentages only for assigned reference.
- `--quantification_window_coordinates` (string): Coordinates for the quantification window.
- `--annotate_wildtype_allele` (boolean): Annotate the wildtype allele.
- `--keep_intermediate` (boolean): Keep intermediate files.
- `--dump` (boolean): Dump all data.
- `--write_detailed_allele_table` (boolean): Write a detailed allele table.
- `--fastq_output` (boolean): Output in FASTQ format.
- `--bam_output` (boolean): Output in BAM format.
- `--bowtie2_index` (string): Path to the Bowtie2 index.
- `--zip_output` (boolean): Compress output files.
- `--max_rows_alleles_around_cut_to_plot` (integer): Maximum rows for allele plots around the cut.
- `--suppress_report` (boolean): Suppress the report.
- `--place_report_in_output_folder` (boolean): Place the report in the output folder.
- `--suppress_plots` (boolean): Suppress plots.
- `--base_editor_output` (boolean): Output for base editor analysis.
- `--conversion_nuc_from` (string): Nucleotide to convert from for base editing.
- `--conversion_nuc_to` (string): Nucleotide to convert to for base editing.
- `--prime_editing_pegRNA_spacer_seq` (string): Spacer sequence for prime editing pegRNA.
- `--prime_editing_pegRNA_extension_seq` (string): Extension sequence for prime editing pegRNA.
- `--prime_editing_pegRNA_extension_quantification_window_size` (integer): Quantification window size for prime editing pegRNA extension.
- `--prime_editing_pegRNA_scaffold_seq` (string): Scaffold sequence for prime editing pegRNA.
- `--prime_editing_pegRNA_scaffold_min_match_length` (integer): Minimum match length for prime editing pegRNA scaffold.
- `--prime_editing_nicking_guide_seq` (string): Nicking guide sequence for prime editing.
- `--prime_editing_override_prime_edited_ref_seq` (boolean): Override prime edited reference sequence.
- `--prime_editing_override_sequence_checks` (boolean): Override sequence checks for prime editing.
- `--crispresso1_mode` (boolean): Use CRISPResso1 mode.
- `--dsODN` (boolean): Use dsODN.
- `--auto` (boolean): Automatic mode.
- `--debug` (boolean): Enable debug mode.
- `--no_rerun` (boolean): Do not rerun analysis.
- `--n_processes` (integer): Number of processes to use.
- `--bam_input` (string): Path to BAM input file.
- `--bam_chr_loc` (string): Chromosomal location for BAM input.
- `--batch_settings` (string): Path to batch settings file.
- `--skip_failed` (boolean): Skip failed analyses.
- `--min_reads_for_inclusion` (integer): Minimum reads for inclusion.
- `--batch_output_folder` (string): Output folder for batch analysis.
- `--suppress_batch_summary_plots` (boolean): Suppress batch summary plots.
- `--crispresso_command` (string): Path to CRISPResso executable.
- `--disable_guardrails` (boolean): Disable guardrails.
- `--use_matplotlib` (boolean): Use Matplotlib for plotting.
- `--halt_on_plot_fail` (boolean): Halt execution if plotting fails.
```

--------------------------------

### Run CRISPRessoBatch using Bioconda

Source: https://docs.crispresso.com/latest/batch/examples.html

Execute CRISPResso in batch mode using the Bioconda installation. Ensure you have the necessary dataset files and a batch file configured.

```bash
CRISPRessoBatch --batch_settings batch.batch --amplicon_seq CATTGCAGAGAGGCGTATCATTTCGCGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCC -p 4 --base_editor_output -g GGAATCCCTTCTGCAGCACC -wc -10 -w 20
```

--------------------------------

### Run CRISPRessoAggregate with Docker

Source: https://docs.crispresso.com/latest/aggregate/examples.html

Execute CRISPRessoAggregate using Docker. This command mounts the current directory to the container and sets it as the working directory. It's useful for running CRISPResso without local installation.

```bash
docker run -v ${PWD}:/DATA -w /DATA -i pinellolab/crispresso2 CRISPRessoAggregate --name "VEGFA" --prefix CRISPRessoRuns/VEGFA/
```

--------------------------------

### Analyze Allele-Specific Editing with CRISPResso (Bioconda)

Source: https://docs.crispresso.com/latest/core/examples.html

Analyze allele-specific editing experiments using CRISPResso installed via Bioconda. Requires specifying multiple amplicon sequences and names.

```bash
CRISPResso --fastq_r1 allele_specific.fastq.gz --amplicon_seq CGAGAGCCGCAGCCATGAACGGCACAGAGGGCCCCAATTTTTATGTGCCCTTCTCCAACGTCACAGGCGTGGTGCGGAGCCACTTCGAGCAGCCGCAGTACTACCTGGCGGAACCATGGCAGTTCTCCATGCTGGCAGCGTACATGTTCCTGCTCATCGTGCTGGG,CGAGAGCCGCAGCCATGAACGGCACAGAGGGCCCCAATTTTTATGTGCCCTTCTCCAACGTCACAGGCGTGGTGCGGAGCCCCTTCGAGCAGCCGCAGTACTACCTGGCGGAACCATGGCAGTTCTCCATGCTGGCAGCGTACATGTTCCTGCTCATCGTGCTGGG --amplicon_name P23H,WT --guide_seq GTGCGGAGCCACTTCGAGCAGC
```

--------------------------------

### Analyze Base Editing Experiments with CRISPResso (Bioconda)

Source: https://docs.crispresso.com/latest/core/examples.html

Analyze base editing experiments using CRISPResso installed via Bioconda. Specify quantification window parameters and enable base editor output.

```bash
CRISPResso --fastq_r1 base_editor.fastq.gz --amplicon_seq GGCCCCAGTGGCTGCTCTGGGGGCCTCCTGAGTTTCTCATCTGTGCCCCTCCCTCCCTGGCCCAGGTGAAGGTGTGGTTCCAGAACCGGAGGACAAAGTACAAACGGCAGAAGCTGGAGGAGGAAGGGCCTGAGTCCGAGCAGAAGAAGAAGGGCTCCCATCACATCAACCGGTGGCGCATTGCCACGAAGCAGGCCAATGGGGAGGACATCGATGTCACCTCCAATGACTAGGGTGG --guide_seq GAGTCCGAGCAGAAGAAGAA --quantification_window_size 10 --quantification_window_center -10 --base_editor_output
```

--------------------------------

### Analyze Base Editing Experiments with CRISPResso (Docker)

Source: https://docs.crispresso.com/latest/core/examples.html

Analyze base editing experiments using CRISPResso via Docker. Mount the current directory to /DATA and specify quantification window parameters.

```bash
docker run -v ${PWD}:/DATA -w /DATA -i pinellolab/crispresso2 CRISPResso --fastq_r1 base_editor.fastq.gz --amplicon_seq GGCCCCAGTGGCTGCTCTGGGGGCCTCCTGAGTTTCTCATCTGTGCCCCTCCCTCCCTGGCCCAGGTGAAGGTGTGGTTCCAGAACCGGAGGACAAAGTACAAACGGCAGAAGCTGGAGGAGGAAGGGCCTGAGTCCGAGCAGAAGAAGAAGGGCTCCCATCACATCAACCGGTGGCGCATTGCCACGAAGCAGGCCAATGGGGAGGACATCGATGTCACCTCCAATGACTAGGGTGG --guide_seq GAGTCCGAGCAGAAGAAGAA --quantification_window_size 10 --quantification_window_center -10 --base_editor_output
```

--------------------------------

### Analyze Allele-Specific Editing with CRISPResso (Docker)

Source: https://docs.crispresso.com/latest/core/examples.html

Analyze allele-specific editing experiments using CRISPResso via Docker. Mount the current directory to /DATA.

```bash
docker run -v ${PWD}:/DATA -w /DATA -i pinellolab/crispresso2 CRISPResso --fastq_r1 allele_specific.fastq.gz --amplicon_seq CGAGAGCCGCAGCCATGAACGGCACAGAGGGCCCCAATTTTTATGTGCCCTTCTCCAACGTCACAGGCGTGGTGCGGAGCCACTTCGAGCAGCCGCAGTACTACCTGGCGGAACCATGGCAGTTCTCCATGCTGGCAGCGTACATGTTCCTGCTCATCGTGCTGGG,CGAGAGCCGCAGCCATGAACGGCACAGAGGGCCCCAATTTTTATGTGCCCTTCTCCAACGTCACAGGCGTGGTGCGGAGCCCCTTCGAGCAGCCGCAGTACTACCTGGCGGAACCATGGCAGTTCTCCATGCTGGCAGCGTACATGTTCCTGCTCATCGTGCTGGG --amplicon_name P23H,WT --guide_seq GTGCGGAGCCACTTCGAGCAGC
```

--------------------------------

### Compare CRISPResso results

Source: https://docs.crispresso.com/latest/compare/examples.html

Execute a comparison between two CRISPResso analysis directories to generate efficiency metrics and mutation profiles.

```bash
CRISPRessoCompare -n1 "VEGFA CRISPR" -n2 "VEGFA CONTROL"  -n VEGFA_Site_1_SRR10467_VS_SRR1046787 CRISPResso_on_VEGFA_Site_1_SRR1046762/ CRISPResso_on_VEGFA_Site_1_SRR1046787/
```

```bash
docker run -v ${PWD}:/DATA -w /DATA -i pinellolab/crispresso2 CRISPRessoCompare -n1 "VEGFA CRISPR" -n2 "VEGFA CONTROL"  -n VEGFA_Site_1_SRR10467_VS_SRR1046787 CRISPResso_on_VEGFA_Site_1_SRR1046762/ CRISPResso_on_VEGFA_Site_1_SRR1046787/
```

--------------------------------

### Analyze Paired-End Sequencing Data with CRISPResso (Docker)

Source: https://docs.crispresso.com/latest/core/examples.html

Use this command to analyze paired-end sequencing data using CRISPResso via Docker. Mount the current directory to /DATA.

```bash
docker run -v ${PWD}:/DATA -w /DATA -i pinellolab/crispresso2 CRISPResso --fastq_r1 nhej.r1.fastq.gz --fastq_r2 nhej.r2.fastq.gz --amplicon_seq AATGTCCCCCAATGGGAAGTTCATCTGGCACTGCCCACAGGTGAGGAGGTCATGATCCCCTTCTGGAGCTCCCAACGGGCCGTGGTCTGGTTCATCATCTGTAAGAATGGCTTCAAGAGGCTCGGCTGTGGTT -n nhej
```

--------------------------------

### Analyze Paired-End Sequencing Data with CRISPResso (Bioconda)

Source: https://docs.crispresso.com/latest/core/examples.html

Use this command to analyze paired-end sequencing data using CRISPResso installed via Bioconda. Ensure test datasets are downloaded.

```bash
CRISPResso --fastq_r1 nhej.r1.fastq.gz --fastq_r2 nhej.r2.fastq.gz --amplicon_seq AATGTCCCCCAATGGGAAGTTCATCTGGCACTGCCCACAGGTGAGGAGGTCATGATCCCCTTCTGGAGCTCCCAACGGGCCGTGGTCTGGTTCATCATCTGTAAGAATGGCTTCAAGAGGCTCGGCTGTGGTT -n nhej
```

--------------------------------

### Run CRISPRessoBatch using Docker

Source: https://docs.crispresso.com/latest/batch/examples.html

Execute CRISPResso in batch mode using a Docker container. This command mounts the current directory to the container's working directory.

```bash
docker run -v ${PWD}:/DATA -w /DATA -i pinellolab/crispresso2 CRISPRessoBatch --batch_settings batch.batch --amplicon_seq CATTGCAGAGAGGCGTATCATTTCGCGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCC -p 4 --base_editor_output -g GGAATCCCTTCTGCAGCACC -wc -10 -w 20
```

--------------------------------

### Run CRISPRessoPooled in Mixed Mode (Docker)

Source: https://docs.crispresso.com/latest/pooled/examples.html

Execute CRISPRessoPooled using Docker for mixed amplicon and genome analysis. Mounts local directories to the container and requires paired-end reads, an amplicon description file, and a reference genome.

```bash
docker run -v ${PWD}:/DATA -w /DATA -i pinellolab/crispresso2 CRISPRessoPooled -r1 SRR1046762_1.fastq.gz -r2 SRR1046762_2.fastq.gz -f AMPLICONS_FILE.txt -x /GENOMES/hg19/hg19 --name AMPLICONS_AND_GENOME_SRR1046762 --gene_annotations gencode_v19.gz
```

--------------------------------

### Run CRISPRessoWGS via Docker

Source: https://docs.crispresso.com/latest/wgs/examples.html

Execute CRISPRessoWGS within a Docker container, mounting the current directory to /DATA.

```bash
docker run -v ${PWD}:/DATA -w /DATA -i pinellolab/crispresso2 CRISPRessoWGS -b WGS/50/50_sorted_rmdup_fixed_groups.bam -f WGS_TEST.txt -r /GENOMES/mm9/mm9.fa --gene_annotations ensemble_mm9.txt.gz --name CRISPR_WGS_SRR1542350
```

--------------------------------

### Configure CRISPRessoPro settings

Source: https://docs.crispresso.com/latest/pro/tool.html

Use this JSON structure to define custom plot colors and guardrail thresholds for CRISPRessoPro analysis.

```json
{
  "colors": {
    "Substitution": "#0000FF",
    "Insertion": "#008000",
    "Deletion": "#FF0000",
    "A": "#7FC97F",
    "T": "#BEAED4",
    "C": "#FDC086",
    "G": "#FFFF99",
    "N": "#C8C8C8",
    "-": "#1E1E1E"
  },
  "guardrails": {
    "min_total_reads": 10000,
    "aligned_cutoff": 0.9,
    "alternate_alignment": 0.3,
    "min_ratio_of_mods_in_to_out": 0.01,
    "modifications_at_ends": 0.01,
    "outside_window_max_sub_rate": 0.002,
    "max_rate_of_subs": 0.3,
    "guide_len": 19,
    "amplicon_len": 50,
    "amplicon_to_read_length": 1.5
  }
}
```

--------------------------------

### CRISPResso Input Parameters

Source: https://docs.crispresso.com/latest/parameters.html

Parameters related to input files and amplicon sequences.

```APIDOC
## CRISPResso Input Parameters

### Description
Parameters for specifying input FASTQ files and amplicon sequences.

### Parameters
#### Input Files
- **First fastq file** (str) - Required - Path to the first FASTQ file for single-end or paired-end reads.
- **Second fastq file for paired end reads** (str) - Optional - Path to the second FASTQ file for paired-end reads.

#### Amplicon Specification
- **Amplicon Sequence** (str) - Required - Comma-separated list of amplicon sequences.
- **Amplicon Name** (str) - Optional - Comma-separated list of amplicon names, corresponding to the sequences.
- **Amplicon Minimum Alignment Score** (str) - Optional - Comma-separated list of minimum homology scores (0-100) for alignment.
- **Default minimum homology score** (int) - Optional - Default minimum homology score for read alignment. Default: 60.
- **Ambiguous alignments count equally** (bool) - Optional - If true, reads aligning to multiple amplicons count equally. Default: False.
- **Assign ambiguous reads to first amplicon** (bool) - Optional - If true, ambiguous reads are assigned to the first amplicon. Default: False.
- **Amplicon sequence expected after HDR** (str) - Optional - The expected amplicon sequence after HDR.

#### sgRNA Specification
- **sgRNA sequence** (str) - Required - sgRNA sequence(s), comma-separated if multiple.
- **sgRNA names** (str) - Optional - sgRNA name(s), comma-separated if multiple.
- **sgRNA sequence (flexible)** (str) - Optional - Flexible sgRNA sequence(s), comma-separated. Default: None.
- **flexiguide homology** (int) - Optional - Minimum homology score for flexiguides. Default: 80.
- **flexiguide name** (str) - Optional - Name for the flexiguide sequence.

#### Cleavage Offset
- **cleavage offset** (int) - Optional - Offset for cleavage position. Default: -3.
- **cleavage offset** (int) - Optional - Offset for cleavage position. Default: -2.

#### Other Options
- **Exclude bp beyond amplicon end** (bool) - Optional - If true, discard positions that extend beyond amplicon ends. Default: False.
- **Subsequence for frameshift analysis** (str) - Optional - Comma-separated subsequences for frameshift analysis.
- **Configuration file path** (str) - Optional - Path to a JSON configuration file. Default: None.

### Request Example
```json
{
  "first_fastq": "input_R1.fastq",
  "second_fastq": "input_R2.fastq",
  "amplicon_seq": "AGCTAGCTAGCT",
  "amplicon_name": "Amplicon1",
  "sgrna_seq": "TTAGCGCGCGGC"
}
```

### Response
#### Success Response (200)
- **Status** (string) - Indicates successful processing.

#### Response Example
```json
{
  "status": "Processing complete"
}
```
```