### Example Data Setup

Source: https://bioconductor.org/packages/release/bioc/vignettes/Doscheda/inst/doc/Doscheda.html

Demonstrates the setup of a fabricated dataset for package examples, including setting parameters and data.

```APIDOC
# 9 Example
To supplement this package, a fabricated data set has been produced. This example is supposed to be the ‘longest’ version of the pipeline. That is, it uses peptide intensities and therefore requires summarising these intensities. The `doschedaData` is used in this vignette and one can see all of the parameters needed by reading the example below.

### Setup
```R
channelNames <- c("Abundance..F1..126..Control..REP_1",
"Abundance..F1..127..Sample..REP_1",  "Abundance..F1..128..Sample..REP_1",
  "Abundance..F1..129..Sample..REP_1",  "Abundance..F1..130..Sample..REP_1",
"Abundance..F1..131..Sample..REP_1",  "Abundance..F2..126..Control..REP_2",
 "Abundance..F2..127..Sample..REP_2", "Abundance..F2..128..Sample..REP_2",
"Abundance..F2..129..Sample..REP_2",  "Abundance..F2..130..Sample..REP_2",
"Abundance..F2..131..Sample..REP_2")
 ex <- new('ChemoProtSet')
 ex<- setParameters(x = ex,chansVal = 6, repsVal = 2,dataTypeStr = 'intensity',
  modelTypeStr = 'linear',PDBool = FALSE,removePepsBool = FALSE,
  incPDofPDBool = FALSE,incGeneFileBool = FALSE,organismStr = 'H.sapiens',pearsonThrshVal = 0.4)
 ex<- setData(x = ex, dataFrame = doschedaData, dataChannels = channelNames,
 accessionChannel = "Master.Protein.Accessions",
               sequenceChannel = 'Sequence', qualityChannel = "Qvality.PEP" )
ex <- removePeptides(ex,removePeps = FALSE)
ex <- runNormalisation(ex)
ex <- fitModel(ex)
ex
```
```

--------------------------------

### Get Example Configuration File Path

Source: https://bioconductor.org/packages/release/bioc/vignettes/amplican/inst/doc/amplicanOverview.html

Use this command to find the path to an example configuration file within the installed amplican package.

```r
system.file("extdata", "config.csv", package = "amplican")
```

--------------------------------

### Install and Run Timesweep Example

Source: https://bioconductor.org/packages/release/bioc/readmes/timescape/README

Installs the timesweep package from a local directory and runs its example function. Ensure you replace '<your_directory>' with the actual path to the package.

```r
devtools::install("<your_directory>/timesweep")
```

```r
library("timesweep")
```

```r
example("timesweep")
```

--------------------------------

### Load example files using system.file

Source: https://bioconductor.org/packages/release/bioc/vignettes/HiCaptuRe/inst/doc/vignetteIntroduction.html

Access bundled example datasets from the HiCaptuRe package installation directory.

```R
ibed1_file <- system.file("extdata", "ibed1_example.zip", package = "HiCaptuRe")
ibed2_file <- system.file("extdata", "ibed2_example.zip", package = "HiCaptuRe")
peakmatrix_file <- system.file("extdata", "peakmatrix_example.zip", package = "HiCaptuRe")
annotation_file <- system.file("extdata", "annotation_example.txt", package = "HiCaptuRe")
```

--------------------------------

### Demonstrate Optimized Setup with Exclusions

Source: https://bioconductor.org/packages/release/bioc/vignettes/OSAT/inst/doc/OSAT.R

Example of creating an optimized setup while excluding specific wells.

```R
## # for demonstration, assume 10 bad samples
## badSample <- sample(576, 10, replace=FALSE)  
## # create sample object using available samples
## gs3 <- setup.sample(pheno[-badSample, ], 
##       optimal=c("SampleType", "Race", "AgeGrp"), 
##       strata=c("SampleType") )
## # use the same container setup as before
## # demonstration only. nSim=5000 or more are commonly used.
## gSetup3 <- create.optimized.setup(sample=gs3, 
##         container=gc, nSim=1000)
```

```R
excludedWells <- data.frame(plates=1:6, chips=rep(1,6), 
                 wells=rep(1,6))
```

```R
ex2 <- data.frame(wells=1)
```

```R
gc3 <- setup.container(IlluminaBeadChip96Plate, 6, 
            batch='plates', exclude=excludedWells)
```

```R
cnt <- setup.container(IlluminaBeadChip96Plate, 2, batch='chips')
```

--------------------------------

### R CMD INSTALL Command Example

Source: https://bioconductor.org/packages/release/bioc/news/iCheck/NEWS

Example of how to install an R package from source using 'R CMD INSTALL' with preclean options.

```bash
R CMD INSTALL --preclean --library=libdir iCheck_0.99.0.tar.gz
```

--------------------------------

### Install and load pathlinkR

Source: https://bioconductor.org/packages/release/bioc/vignettes/pathlinkR/inst/doc/pathlinkR.html

Setup instructions for loading the package and its dependencies.

```R
# We'll also be using some functions from dplyr
# BiocManager::install("pathlinkR", version="devel")
library(dplyr)
library(pathlinkR)
```

--------------------------------

### Initialize Example FastQ Files and Output Prefix

Source: https://bioconductor.org/packages/release/bioc/vignettes/Rfastp/inst/doc/Rfastp.html

Set up paths to example FastQ files and a temporary directory for output. These variables are used in subsequent examples.

```R
se_read1 <- system.file("extdata","Fox3_Std_small.fq.gz",package="Rfastp")
pe_read1 <- system.file("extdata","reads1.fastq.gz",package="Rfastp")
pe_read2 <- system.file("extdata","reads2.fastq.gz",package="Rfastp")
outputPrefix <- tempfile(tmpdir = tempdir())
```

--------------------------------

### Set up file paths

Source: https://bioconductor.org/packages/release/bioc/vignettes/methylMnM/inst/doc/methylMnM.R

Locate the package example data and set the working directory for output files.

```R
datafile<-system.file("extdata",  package = "methylMnM")
filepath<-datafile[1]
```

```R
dirwrite<-paste(setwd(getwd()),"/",sep="")
```

--------------------------------

### Browse midasHLA Vignettes

Source: https://bioconductor.org/packages/release/bioc/html/midasHLA.html

Open the vignettes for the installed midasHLA package in R to get a quick start and tutorial.

```r
browseVignettes("midasHLA")
```

--------------------------------

### Get Path to Auxiliary File

Source: https://bioconductor.org/packages/release/bioc/vignettes/QuasR/inst/doc/QuasR.html

Retrieves the system path to an example auxiliary file included with the QuasR package installation.

```R
auxFile <- system.file(package = "QuasR", "extdata", "auxiliaries.txt")
```

--------------------------------

### Browse GenomeInfoDb Vignettes

Source: https://bioconductor.org/packages/release/bioc/html/GenomeInfoDb.html

This R command opens the vignettes for the installed GenomeInfoDb package, providing introductory guides and examples.

```r
browseVignettes("GenomeInfoDb")
```

--------------------------------

### View flowMerge Vignettes

Source: https://bioconductor.org/packages/release/bioc/html/flowMerge.html

Open the documentation vignettes for the installed flowMerge package in R. This provides detailed examples and usage guides.

```r
browseVignettes("flowMerge")
```

--------------------------------

### Initialize recoup and access help

Source: https://bioconductor.org/packages/release/bioc/vignettes/recoup/inst/doc/recoup_intro.html

Load the package and open the main help documentation.

```R
library(recoup)
help(recoup)
```

--------------------------------

### Quickstart simulation workflow

Source: https://bioconductor.org/packages/release/bioc/vignettes/splatter/inst/doc/splatter.html

Demonstrates the two-step process of estimating parameters from an existing SingleCellExperiment object and generating a new simulated dataset.

```R
# Load package
suppressPackageStartupMessages({
    library(splatter)
    library(scater)
})

# Create mock data
set.seed(1)
sce <- mockSCE()

# Estimate parameters from mock data
params <- splatEstimate(sce)
#> NOTE: Library sizes have been found to be normally distributed instead of log-normal. You may want to check this is correct.
# Simulate data using estimated parameters
sim <- splatSimulate(params)
#> Getting parameters...
#> Creating simulation object...
#> Simulating library sizes...
#> Simulating gene means...
#> Simulating BCV...
#> Warning in splatSimBCVMeans(sim, params): 'bcv.df' is infinite. This parameter
#> will be ignored.
#> Simulating counts...
#> Simulating dropout (if needed)...
#> Sparsifying assays...
#> Automatically converting to sparse matrices, threshold = 0.95
#> Skipping 'BatchCellMeans': estimated sparse size 1.5 * dense matrix
#> Skipping 'BaseCellMeans': estimated sparse size 1.5 * dense matrix
#> Skipping 'BCV': estimated sparse size 1.5 * dense matrix
#> Skipping 'CellMeans': estimated sparse size 1.5 * dense matrix
#> Skipping 'TrueCounts': estimated sparse size 2.72 * dense matrix
#> Skipping 'counts': estimated sparse size 2.72 * dense matrix
#> Done!
```

--------------------------------

### Browse anndataR Vignettes

Source: https://bioconductor.org/packages/release/bioc/html/anndataR.html

Open the documentation vignettes for the installed anndataR package in R. This provides detailed examples and usage guides.

```r
browseVignettes("anndataR")
```

--------------------------------

### Start R Help

Source: https://bioconductor.org/packages/release/bioc/vignettes/QuasR/inst/doc/QuasR.html

Access R's built-in help system to get started. This can be done directly from the R prompt or through the R GUI.

```R
help.start()
```

--------------------------------

### View OMICsPCA Vignettes

Source: https://bioconductor.org/packages/release/bioc/html/OMICsPCA.html

Opens the documentation vignettes for the installed OMICsPCA package in R. This provides detailed usage examples and guides.

```r
browseVignettes("OMICsPCA")
```

--------------------------------

### Load Example Dataset

Source: https://bioconductor.org/packages/release/bioc/vignettes/ncGTW/inst/doc/ncGTW.html

Initialize the package and locate the example data files included in the package.

```R
library(xcms)
library(ncGTW)
filepath <- system.file("extdata", package = "ncGTW")
file <- list.files(filepath, pattern = "mzxml", full.names = TRUE)
# The paths of the 20 samples
```

--------------------------------

### View MBttest Vignettes

Source: https://bioconductor.org/packages/release/bioc/html/MBttest.html

Open the documentation vignettes for the installed MBttest package in R. This provides detailed examples and usage guides.

```R
browseVignettes("MBttest")
```

--------------------------------

### Load KinSwingR and Example Data

Source: https://bioconductor.org/packages/release/bioc/vignettes/KinSwingR/inst/doc/KinSwingR.html

Initialize the environment by loading the package and the required example datasets.

```R
library(KinSwingR)
data(example_phosphoproteome)
data(phosphositeplus_human)

# View the datasets:
head(example_phosphoproteome)
```

--------------------------------

### View LinkHD Vignettes

Source: https://bioconductor.org/packages/release/bioc/html/LinkHD.html

Open the documentation vignettes for the installed LinkHD package in R. This provides detailed examples and usage guides.

```R
browseVignettes("LinkHD")
```

--------------------------------

### Load msPurity package and get mzML file paths

Source: https://bioconductor.org/packages/release/bioc/vignettes/msPurity/inst/doc/msPurity-vignette.html

Loads the msPurity R package and retrieves the paths to example mzML files from the installed package data. Ensure the msPurityData package is installed.

```R
library(msPurity)
msPths <- list.files(system.file("extdata", "lcms", "mzML", package="msPurityData"), full.names = TRUE)
```

--------------------------------

### Example Dockerfile for Report Tool

Source: https://bioconductor.org/packages/release/bioc/vignettes/sevenbridges/inst/doc/bioc-workflow.html

A sample Dockerfile for setting up a R-based report tool environment, including package installations and script setup.

```Dockerfile
FROM rocker/tidyverse

LABEL maintainer="soner.koc@sevenbridges.com"

RUN rm -f /var/lib/dpkg/available \
    && rm -rf  /var/cache/apt/* \
    && apt-get update \
    && apt-get install -y libssl-dev

RUN R -e "install.packages(c('packrat', 'devtools', 'rsconnect', 'shiny', 'rmarkdown'), repos = 'https://cloud.r-project.org/')"

ADD src/report.R /usr/local/bin/

RUN chmod a+x /usr/local/bin/report.R
```

--------------------------------

### Prepare example data

Source: https://bioconductor.org/packages/release/bioc/vignettes/infinityFlow/inst/doc/training_non_default_regression_models.html

Set up the environment and prepare input data for the Infinity Flow pipeline.

```R
library(infinityFlow)

data(steady_state_lung)
data(steady_state_lung_annotation)
data(steady_state_lung_backbone_specification)

dir <- file.path(tempdir(), "infinity_flow_example")
input_dir <- file.path(dir, "fcs")
write.flowSet(steady_state_lung, outdir = input_dir)
#> [1] "/tmp/RtmpCfxtW2/infinity_flow_example/fcs"

write.csv(steady_state_lung_backbone_specification, file = file.path(dir, "backbone_selection_file.csv"), row.names = FALSE)

path_to_fcs <- file.path(dir, "fcs")
path_to_output <- file.path(dir, "output")
path_to_intermediary_results <- file.path(dir, "tmp")
backbone_selection_file <- file.path(dir, "backbone_selection_file.csv")

targets <- steady_state_lung_annotation$Infinity_target
names(targets) <- rownames(steady_state_lung_annotation)
isotypes <- steady_state_lung_annotation$Infinity_isotype
names(isotypes) <- rownames(steady_state_lung_annotation)

input_events_downsampling <- 1000
prediction_events_downsampling <- 500
cores = 1L
```

--------------------------------

### Get Data Path

Source: https://bioconductor.org/packages/release/bioc/vignettes/HELP/inst/doc/HELP.R

Retrieves the file path to the 'pipeline.data' directory within the installed HELP package. This is often used to access example datasets.

```r
data.path <- system.file("pipeline.data", package="HELP")
```

--------------------------------

### Setup and Configuration

Source: https://bioconductor.org/packages/release/bioc/vignettes/Guitar/inst/doc/Guitar-Overview.R

Initializes the environment and sets global chunk options for the R session.

```R
library(knitr)
# set global chunk options
opts_chunk$set(concordance=TRUE)
```

```R
options(width=60)
```

--------------------------------

### Initial setup for igmoExon analysis

Source: https://bioconductor.org/packages/release/bioc/vignettes/puma/inst/doc/puma.R

Sets example paths for CEL files and sample name tables, and provides a commented-out call to the igmoExon function. This serves as a template for initiating an analysis.

```R
## cel.path<-"cel.path"  ## for example  cel.path<-"/home/gao/celData"  
## SampleNameTable<-"SampleNameTable" 
## eset_igmoExon<-igmoExon(cel.path="cel.path",SampleNameTable="SampleNameTable"
##                        , exontype="Human" 
##                        , gsnorm="none", condition="Yes")
```

--------------------------------

### Basic Workflow Setup

Source: https://bioconductor.org/packages/release/bioc/vignettes/CellBarcode/inst/doc/UMI_VDJ_Barcode.html

Initializes the CellBarcode package for a basic workflow by loading necessary libraries. This example assumes the 'stringr' and 'magrittr' packages are installed.

```R
# install.packages("stringr")
library(CellBarcode)
library(magrittr)

# The example data is the mix of MEF lines with known barcodes

```

--------------------------------

### View scTreeViz Vignettes

Source: https://bioconductor.org/packages/release/bioc/html/scTreeViz.html

Run this R command to open the documentation vignettes for the installed scTreeViz package. This provides detailed examples and usage guides.

```r
browseVignettes("scTreeViz")
```

--------------------------------

### Create an example package

Source: https://bioconductor.org/packages/release/bioc/vignettes/biocthis/inst/doc/biocthis.html

Initialize a temporary package for demonstration purposes using biocthis_example_pkg.

```R
## Create an example package for illustrative purposes.
## Note: you do not need to run this for your own package!
pkgdir <- biocthis_example_pkg("biocthispkg", use_git = TRUE)
```

--------------------------------

### Setup and Helper Functions

Source: https://bioconductor.org/packages/release/bioc/vignettes/abseqR/inst/doc/abseqR.R

Initializes required libraries and defines helper functions for file path management and package references.

```R
library(abseqR)
library(png)
library(plotly)
library(grid)
library(gridExtra)
library(BiocStyle)
# knitr::opts_chunk$set(tidy = TRUE)
knitr::opts_chunk$set(message = FALSE)

## ----abseqR_vignette_helper_functions, include=FALSE--------------------------
sabseqR <- function() { return(Biocpkg("abseqR")); }
#sabseqR <- function() { return("`abseqR`"); }
sabseqPy <- function() { return("[abseqPy](https://github.com/malhamdoosh/abseqPy)"); }
sabseq <- function() { return("`AbSeq`"); }
read_png <- function(path) {
    if (file.exists(path)) {
        #rasterGrob(as.raster(readPNG(path)), interpolate = TRUE)
        # in windows, the path is \ but LaTEX does not appreciate these slashes
        knitr::include_graphics(gsub("\\", "/",
                                     normalizePath(path),
                                     fixed = TRUE))
    } else {
        stop("File at ", path, " not found, fatal.")
    }
}
```

--------------------------------

### View CoverageView Vignettes

Source: https://bioconductor.org/packages/release/bioc/html/CoverageView.html

Run this R command to access the documentation vignettes for the installed CoverageView package. This provides detailed examples and usage guides.

```r
browseVignettes("CoverageView")
```

--------------------------------

### Load Example Files

Source: https://bioconductor.org/packages/release/bioc/vignettes/scruff/inst/doc/scruff.R

Load scruff and patchwork libraries and define paths to example FASTQ, FASTA, and GTF files.

```R
library(scruff)
library(patchwork)

# Get the paths to example FASTQ, FASTA, and GTF files.
# Please note that because the following files are included in
# scruff R package, we use system.file() function to extract the paths
# to these files. If the user is running scruff on real data, the
# paths to the input FASTQ, FASTA, and GTF files should be provided,
# and there is no need to call system.file() function. For example,
# v1h1R1 <- "/PATH/TO/vandenBrink_1h1_L001_R1_001.fastq.gz"
# fasta <- "/Path/TO/GRCm38_MT.fa"
v1h1R1 <- system.file("extdata",
    "vandenBrink_1h1_L001_R1_001.fastq.gz",
    package = "scruff")
v1h1R2 <- system.file("extdata",
    "vandenBrink_1h1_L001_R2_001.fastq.gz",
    package = "scruff")
fasta <- system.file("extdata", "GRCm38_MT.fa", package = "scruff")
gtf <- system.file("extdata", "GRCm38_MT.gtf", package = "scruff")
```

--------------------------------

### Get Path to Bin Table

Source: https://bioconductor.org/packages/release/bioc/vignettes/HiCBricks/inst/doc/IntroductionToHiCBricks.html

Obtain the file path to the example bin table provided with the HiCBricks package. This table specifies genomic coordinates for Hi-C data bins. Ensure the package is installed to access its example data.

```R
Bintable_path <- system.file(file.path("extdata",
"Bintable_100kb.bins"), package = "HiCBricks")
```

--------------------------------

### Browse ChAMP Package Vignettes

Source: https://bioconductor.org/packages/release/bioc/html/ChAMP.html

This R command opens the documentation vignettes for the installed ChAMP package. Vignettes provide detailed examples and usage guides.

```r
browseVignettes("ChAMP")
```

--------------------------------

### Setup Shiny Apps Directory

Source: https://bioconductor.org/packages/release/bioc/vignettes/sevenbridges/inst/doc/rstudio.html

Creates the ShinyApps directory and copies example applications into it using R.

```r
dir.create("~/ShinyApps")
file.copy(
  "/usr/local/lib/R/site-library/shiny/examples/01_hello/",
  "~/ShinyApps/", recursive = TRUE
)
```

--------------------------------

### Prepare Local Directory for Upload

Source: https://bioconductor.org/packages/release/bioc/vignettes/gypsum/inst/doc/userguide.html

Creates a temporary directory and writes sample files ('foo', 'bar', 'whee') to it for demonstration purposes. This is a setup step before uploading.

```R
tmp <- tempfile()
dir.create(tmp)
write(file=file.path(tmp, "foo"), letters)
write(file=file.path(tmp, "bar"), LETTERS)
write(file=file.path(tmp, "whee"), 1:10)
```

--------------------------------

### Running bcl2fastq Command

Source: https://bioconductor.org/packages/release/bioc/vignettes/basecallQC/inst/doc/basecallQC.html

This command-line example shows how to run the bcl2fastq tool with specified output directories, sample sheets, and base mask configurations.

```bash
/usr/local/bcl2fastq/bin/bcl2fastq --output-dir  /tmp/RtmpXIZ4kS/Rbuild343220fbe8857/basecallQC/vignettes/C7JE1ANXX --sample-sheet /tmp/RtmpXIZ4kS/Rbuild343220fbe8857/basecallQC/vignettes/C7JE1ANXX.csv --use-bases-mask 1:YYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYN,IIIIIIIIN,YYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYN --use-bases-mask 2:YYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYN,IIIIIIIIN,YYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYN --use-bases-mask 3:YYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYN,IIIIIIIIN,YYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYN --use-bases-mask 4:YYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYN,IIIIIINNN,YYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYN --use-bases-mask 5:YYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYN,IIIIIINNN,YYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYN --use-bases-mask 6:YYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYN,IIIIIIIIN,YYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYN --use-bases-mask 7:YYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYN,IIIIIINNN,YYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYN --use-bases-mask 8:YYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYN,IIIIIINNN,YYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYN
```

--------------------------------

### Load and Prepare Example Data

Source: https://bioconductor.org/packages/release/bioc/vignettes/poem/inst/doc/poem.html

Loads simulated datasets 'g1' and 'g2' from 'toyExamples' and displays the first few rows of 'g1'.

```R
data(toyExamples)
g1 <- toyExamples[toyExamples$graph=="graph1",]
g2 <- toyExamples[toyExamples$graph=="graph2",]
head(g1)
```

--------------------------------

### Install Additional Packages for Examples

Source: https://bioconductor.org/packages/release/bioc/vignettes/diffcyt/inst/doc/diffcyt_workflow.html

Installs the HDCytoData and CATALYST packages, which are necessary to run all examples provided in the diffcyt vignette.

```R
BiocManager::install("HDCytoData")
BiocManager::install("CATALYST")
```

--------------------------------

### Install from GitHub

Source: https://bioconductor.org/packages/release/bioc/vignettes/multistateQTL/inst/doc/multistateQTL.html

Alternative installation method using devtools.

```R
devtools::install_git("https://github.com/dunstone-a/QTLExperiment", build_vignettes=TRUE)
devtools::install_git(https://github.com/dunstone-a/multistateQTL", build_vignettes=TRUE)
```

--------------------------------

### Initialize DExMA Environment

Source: https://bioconductor.org/packages/release/bioc/vignettes/DExMA/inst/doc/DExMA.R

Set up the document style and load the required library and example data.

```R
BiocStyle::latex()
```

```R
library(DExMA)
data("DExMAExampleData")
```

--------------------------------

### Install TFEA.ChIP Package

Source: https://bioconductor.org/packages/release/bioc/html/TFEA.ChIP.html

To install this package, start R and ensure BiocManager is installed, then use BiocManager::install().

```r
if (!require("BiocManager", quietly = TRUE))
    install.packages("BiocManager")

BiocManager::install("TFEA.ChIP")
```

--------------------------------

### Access example datasets

Source: https://bioconductor.org/packages/release/bioc/vignettes/hermes/inst/doc/hermes.html

Opens help documentation for the built-in example datasets.

```R
?expression_set
?summarized_experiment
```

--------------------------------

### Install BiocManager and a Package

Source: https://bioconductor.org/packages/release/bioc/vignettes/microbiomeDASim/inst/doc/microbiomeDASim.R

Install the BiocManager package if it's not already installed, then use it to install the microbiomeDASim package. This is a prerequisite for running the simulation examples.

```r
# if(!requireNamespace("BiocManager", quietly = TRUE)){
#     install.packages("BiocManager")
# }
# BiocManager::install("microbiomeDASim")
```

--------------------------------

### Install leukemiasEset Data Package

Source: https://bioconductor.org/packages/release/bioc/vignettes/geNetClassifier/inst/doc/geNetClassifier-vignette.R

Installs the leukemiasEset data package, which is required for some examples.

```R
BiocManager::install("leukemiasEset")
```

--------------------------------

### Display Example File Name

Source: https://bioconductor.org/packages/release/bioc/vignettes/MACSQuantifyR/inst/doc/MACSQuantifyR_pipeline.html

Prints the name of the loaded example file. This is a confirmation step.

```R
## [1] "drugs.xlsx"
```

--------------------------------

### Display Analysis Started Message

Source: https://bioconductor.org/packages/release/bioc/vignettes/gwasurvivr/inst/doc/gwasurvivr_Introduction.html

Example of a message displayed when the survival analysis starts.

```text
## Analysis started on 2025-10-30 at 00:24:13
```

--------------------------------

### Example Configuration File Structure

Source: https://bioconductor.org/packages/release/bioc/vignettes/amplican/inst/doc/amplicanOverview.html

This is an example of the expected CSV format for the configuration file. Ensure all columns are present and correctly delimited.

```text
ID_1 | barcode_1 | R1_001.fastq | R2_001.fastq | Betty | 0 | AGGTGGTCAGGGAACTGG | AAGCTGACGGCTAAATGA | AATTACACAAGCGCAAACACAC | 0 | aagctgacggctaaatgaaaaatgtcaaacatctgttccaggtgctgcgtatgccagggcagaggAGGTGGTCAGGGAACTGGtggaggtcactgggataccctttcttcccacaccaatggggaaaggagtcctgccagatgaccatcccaactgtgttgctgcagccagatccaggtgtgtttgcgcttgtgtaatt |   
---|---|---|---|---|---|---|---|---|---|---|---
ID_2 | barcode_1 | R1_001.fastq | R2_001.fastq | Tom | 0 | TGACCCTCTGCCAACACAAGGGG | TGACCAAACCTTCTTAAGGTGC | CTCTGCTGCAAAATGCAAGG | 1 | aaatactgtcttgtgaccaaaccttcttaaggtgctattttgataataaactttattgtgcttttgtagttgtgCCCCTTGTGTTGGCAGAGGGTCAgcagaccagtaagtcttctcaatttcttttatttatgtgtagtgataaaaaaatgttaaattaaaattaaatgtttttttttgccttgcattttgcagcagaggatgat |   
ID_3 | barcode_2 | R1_002.fastq | R2_002.fastq | Tom | 0 | AGGTGGTCAGGGAACTGG | AAGCTGACGGCTAAATGA | AATTACACAAGCGCAAACACAC | 0 | aagctgacggctaaatgaaaaatgtcaaacatctgttccaggtgctgcgtatgccagggcagaggAGGTGGTCAGGGAACTGGtggaggtcactgggataccctttcttcccacaccaatggggaaaggagtcctgccagatgaccatcccaactgtgttgctgcagccagatccaggtgtgtttgcgcttgtgtaatt |   
ID_4 | barcode_2 | R1_002.fastq | R2_002.fastq | Betty | 0 | GTCCCTGCAACATTAAAGGCCGG | GCTGGCAACATTCCTACCAGT | GAGCGCTGAGGCAGGATTAT | 0 | gctggcaacattcctaccagtaatttacgtaaaaaaatgctataaaatgtgtagctctccagtctaatgtaacttgtgcttgcattgtgtttacaggaaaccaGTCCCTGCAACATTAAAGGCCGGaagtctaagaactcacatcagcaggtgtcaagtgtgcatgaagagggtataatcctgcctcagcgctc |   
ID_5 | barcode_2 | R1_002.fastq | R2_002.fastq | Betty | 0 | GTCCCTGCAACATTAAAGGCCGG | ACTGGCAACATTCCTACCAGT | ACTGGCTGAGGCAGGATTAT | 0 | actggcaacattcctaccagtaatttacgtaaaaaaatgctataaaatgtgtagctctccagtctaatgtaacttgtgcttgcattgtgtttacaggaaaccaGTCCCTGCAACATTAAAGGCCGGaagtctaagaactcacatcagcaggtgtcaagtgtgcatgaagagggtataatcctgcctcagccagt | actggcaacattcctaccagtaatttacgtaaaaaaatgctataaaatgtgtagctctccagtctaatgtaacttgtgcttgcattgtgtttacaggaaaccaGTCCCTGCAACATTAAAAGCCGGaagtctaagaactcacatcagcaggtgtcaagtgtgcatgaagagggtataatcctgcctcagccagt  
```

--------------------------------

### Install and Load pasillaBamSubset Package

Source: https://bioconductor.org/packages/release/bioc/vignettes/gmoviz/inst/doc/gmoviz_advanced.html

Ensures the 'pasillaBamSubset' package is installed and loaded for example data. Installs 'GenomicAlignments' if 'pasillaBamSubset' is not found.

```R
if (!require("pasillaBamSubset")) {
    if (!require("BiocManager"))
        install.packages("BiocManager")
    BiocManager::install("GenomicAlignments")
}
library(pasillaBamSubset)
```

--------------------------------

### Setup Sample and Container

Source: https://bioconductor.org/packages/release/bioc/vignettes/OSAT/inst/doc/OSAT.R

Initialize sample stratification and container configurations for experimental design.

```R
gs <- setup.sample(pheno, optimal=c("SampleType", "Race", "AgeGrp"),
           strata=c("SampleType"))
gs
```

```R
gc <- setup.container(IlluminaBeadChip96Plate, 6, 
          batch='plates')
gc
```

--------------------------------

### Get example data path

Source: https://bioconductor.org/packages/release/bioc/vignettes/OTUbase/inst/doc/Introduction_to_OTUbase.R

Retrieves the file path to example data included with the OTUbase package. This is useful for running examples.

```r
dirPath <- system.file("extdata/Sogin_2006", package="OTUbase")
```

--------------------------------

### Prepare input sample file

Source: https://bioconductor.org/packages/release/bioc/vignettes/SingleMoleculeFootprinting/inst/doc/methylation_calling_and_QCs.html

Read and display the sample file configuration.

```R
sampleFile = paste0(CacheDir, "/NRF1Pair_sampleFile.txt")
knitr::kable(suppressMessages(readr::read_delim(sampleFile, delim = "\t")))
```

--------------------------------

### Set up environment and options

Source: https://bioconductor.org/packages/release/bioc/vignettes/baySeq/inst/doc/baySeq_generic.R

Initializes random seed and sets output width. Requires the 'parallel' package for cluster creation.

```R
set.seed(102)
options(width = 90)
```

```R
if(require("parallel")) cl <- makeCluster(4) else cl <- NULL
```

--------------------------------

### Install scRNAseq Package

Source: https://bioconductor.org/packages/release/bioc/vignettes/scAnnotatR/inst/doc/training-child-model.html

Installs the scRNAseq package using BiocManager if it's not already installed. This package is used for loading example datasets.

```r
# we use the scRNAseq package to load example data
if (!require(scRNAseq))
  BiocManager::install("scRNAseq")
```

--------------------------------

### Install RcisTarget and supporting packages

Source: https://bioconductor.org/packages/release/bioc/vignettes/RcisTarget/inst/doc/RcisTarget_MainTutorial.html

Installs RcisTarget and optional packages for parallel execution and interactive examples. Ensure BiocManager is installed first.

```R
if (!requireNamespace("BiocManager", quietly=TRUE))
    install.packages("BiocManager")
# To support paralell execution:
BiocManager::install(c("doMC", "doRNG"))
# For the examples in the follow-up section of the tutorial:
BiocManager::install(c("DT", "visNetwork"))
```

--------------------------------

### Install GEVA Package

Source: https://bioconductor.org/packages/release/bioc/vignettes/geva/inst/doc/geva.R

Installs the GEVA package from Bioconductor. This is a commented-out example and requires BiocManager.

```R
# BiocManager::install("geva")
```

--------------------------------

### Install BatchQC from GitHub

Source: https://bioconductor.org/packages/release/bioc/vignettes/BatchQC/inst/doc/BatchQC_Intro.html

Installation procedure for the latest development version using devtools.

```R
if (!require("devtools", quietly = TRUE)) {
    install.packages("devtools")   
}

library(devtools)
install_github("wejlab/BatchQC")
```

--------------------------------

### Initialize MsBackendTest instance with data

Source: https://bioconductor.org/packages/release/bioc/vignettes/Spectra/inst/doc/MsBackend.html

Demonstrates creating an instance of the backend class and populating it with spectra variables, m/z values, and intensities.

```R
## A data.frame with spectra variables.
svars <- data.frame(msLevel = c(1L, 2L, 2L),
                    rtime = c(1.2, 1.3, 1.4))
## m/z values for each spectrum.
mzs <- list(c(12.3, 13.5, 16.5, 17.5),
            c(45.1, 45.2),
            c(64.4, 123.1, 124.1))
## intensity values for each spectrum.
ints <- list(c(123.3, 153.6, 2354.3, 243.4),
             c(100, 80.1),
             c(12.3, 35.2, 100))

## Create and initialize the backend
be <- backendInitialize(MsBackendTest(),
                        svars = svars, mz = mzs, intensity = ints)
be
```

```R
## An object of class "MsBackendTest"
## Slot "spectraVars":
##   msLevel rtime dataStorage      dataOrigin
## 1       1   1.2    <memory> <user provided>
## 2       2   1.3    <memory> <user provided>
## 3       2   1.4    <memory> <user provided>
## 
## Slot "mz":
## NumericList of length 3
## [[1]] 12.3 13.5 16.5 17.5
## [[2]] 45.1 45.2
## [[3]] 64.4 123.1 124.1
## 
## Slot "intensity":
## NumericList of length 3
## [[1]] 123.3 153.6 2354.3 243.4
## [[2]] 100 80.1
## [[3]] 12.3 35.2 100
## 
## Slot "readonly":
## [1] FALSE
## 
## Slot "version":
```

--------------------------------

### Install epimutacionsData Package

Source: https://bioconductor.org/packages/release/bioc/vignettes/epimutacions/inst/doc/epimutacions.html

Installs the epimutacionsData package, which contains example datasets. Requires BiocManager.

```R
if (!requireNamespace("BiocManager", quietly = TRUE))
    install.packages("BiocManager")

BiocManager::install("epimutacionsData")
```

--------------------------------

### Install beadarray dependencies

Source: https://bioconductor.org/packages/release/bioc/vignettes/beadarray/inst/doc/beadsummary.html

Use BiocManager to install the required example data and annotation packages.

```R
install.packages("BiocManager")
BiocManager::install(c("beadarrayExampleData", "illuminaHumanv3.db"))
```

--------------------------------

### Setup Package Environment

Source: https://bioconductor.org/packages/release/bioc/vignettes/SpatialExperimentIO/inst/doc/SpatialExperimentIO.html

Load the required libraries for spatial data handling.

```R
suppressMessages({
  library(SpatialExperimentIO)
  library(SpatialExperiment)
})
```

--------------------------------

### Package Setup and Installation

Source: https://bioconductor.org/packages/release/bioc/vignettes/veloviz/inst/doc/vignette.R

Initializes the knitr environment and provides installation commands for the veloviz package.

```R
knitr::opts_chunk$set(echo = TRUE, results = 'hide')
library(veloviz)
```

```R
# if(!requireNamespace("BiocManager", quietly = TRUE))
#     install.packages("BiocManager")
# BiocManager::install("veloviz")
# 
```

--------------------------------

### Quick Start Analysis Workflow

Source: https://bioconductor.org/packages/release/bioc/vignettes/UMI4Cats/inst/doc/UMI4Cats.html

Demonstrates the initial steps of downloading example data and generating a digested genome for analysis.

```R
## 0) Download example data -------------------------------
path <- downloadUMI4CexampleData()

## 1) Generate Digested genome ----------------------------
# The selected RE in this case is DpnII (|GATC), so the cut_pos is 0, and the res_enz "GATC".
hg19_dpnii <- digestGenome(
    cut_pos = 0,
    res_enz = "GATC",
    name_RE = "DpnII",
    ref_gen = BSgenome.Hsapiens.UCSC.hg19::BSgenome.Hsapiens.UCSC.hg19,
    out_path = file.path(tempdir(), "digested_genome/")
)
```

--------------------------------

### Setup and Load Libraries

Source: https://bioconductor.org/packages/release/bioc/vignettes/weitrix/inst/doc/V4_airway.html

Initializes the environment by loading necessary Bioconductor packages and setting the parallel processing backend.

```R
library(weitrix)
library(ComplexHeatmap)
library(EnsDb.Hsapiens.v86)
library(edgeR)
library(limma)
library(reshape2)
library(tidyverse)
library(airway)

set.seed(1234)

# BiocParallel supports multiple backends. 
# If the default hangs or errors, try others.
# The most reliable backed is to use serial processing
BiocParallel::register( BiocParallel::SerialParam() )
```

--------------------------------

### Get Installed Cytoscape Apps

Source: https://bioconductor.org/packages/release/bioc/news/RCy3/NEWS

Retrieve a list of all installed Cytoscape Apps using `getInstalledApps`.

```R
getInstalledApps()
```

--------------------------------

### Get Example File Paths

Source: https://bioconductor.org/packages/release/bioc/vignettes/podkat/inst/doc/podkat.R

Retrieves the file paths for example phenotype and VCF files included with the podkat package. These are used in subsequent examples.

```R
phenoFileLin <- system.file("examples/example1lin.csv", package="podkat")
phenoFileLog <- system.file("examples/example1log.csv", package="podkat")
vcfFile <- system.file("examples/example1.vcf.gz", package="podkat")
```

--------------------------------

### 0.1 Setup: Input BED files

Source: https://bioconductor.org/packages/release/bioc/vignettes/iscream/inst/doc/performance.html

Instructions and R code for downloading and setting up input BED files and tabix indices from a Zenodo record, and selecting specific cell data.

```APIDOC
## 0.1.1 Input BED files

### Description
Running this vignette requires downloading 2GB of single-cell whole genome bisulfite sequencing (WGBS) BED files and tabix indices from a Zenodo record. This section provides R code to download, unzip, and cache these files, and then select a subset of human cell WGBS data.

### Method
Not applicable (R script execution)

### Endpoint
Not applicable

### Parameters
Not applicable

### Request Example
```R
library("BiocFileCache")
cachedir <- BiocFileCache()
snmc_zip_path <- bfcrpath(cachedir, "https://zenodo.org/records/14733834/files/sc_beds.zip")
snmc_unzip <- file.path(tempdir(), "sc_beds")
unzip(snmc_zip_path, exdir = snmc_unzip)
genes_file <- bfcrpath(cachedir, "https://zenodo.org/records/14733834/files/genes.bed")

snmc_dir <- file.path(snmc_unzip, "sc_biscuit")
bedfiles <- list.files(
  snmc_dir,
  pattern = "*.bed.gz$",
  full.names = TRUE
)[1:100]
```

### Response
Not applicable (R script execution)

### Response Example
Not applicable
```

--------------------------------

### Get Source Path for ompBAM Example

Source: https://bioconductor.org/packages/release/bioc/vignettes/ompBAM/inst/doc/ompBAM-API-Docs.html

Retrieves the system path to the example code for the ompBAM package. This is useful for inspecting or running the provided examples.

```R
source_path = system.file("examples", "ompBAMExample", "src", 
    package = "ompBAM")
```

--------------------------------

### Install and Start DEBrowser

Source: https://bioconductor.org/packages/release/bioc/vignettes/debrowser/inst/doc/DEBrowser.html

Instructions for installing the package via BiocManager and launching the interactive browser interface.

```R
# Installation instructions:
# 1. Install DEBrowser and its dependencies by running the lines below
# in R or RStudio.

if (!requireNamespace("BiocManager", quietly=TRUE))
    install.packages("BiocManager")
BiocManager::install("debrowser")

# 2. Load the library

library(debrowser)

# 3. Start DEBrowser

startDEBrowser()
```

--------------------------------

### Create Experiment Setup

Source: https://bioconductor.org/packages/release/bioc/vignettes/OSAT/inst/doc/OSAT.R

Generate the final experiment setup from sample and container objects.

```R
gSetup0 <- create.experiment.setup(gs, gc)
myAssignment <- get.experiment.setup(gSetup0)
```

--------------------------------

### Initialize Working Directory

Source: https://bioconductor.org/packages/release/bioc/vignettes/RepViz/inst/doc/RepViz.html

Copies example files from the package to a temporary directory and sets it as the working directory.

```R
file.copy(from = list.files(system.file("extdata", package = "RepViz"), full.names = TRUE),to = tempdir())
setwd(tempdir())
```

--------------------------------

### Retrieve Example Genome Path

Source: https://bioconductor.org/packages/release/bioc/vignettes/SpliceWiz/inst/doc/SW_QuickStart.html

Command to get the file path for the example genome included in NxtIRFdata.

```R
# Provides the path to the example genome:
chrZ_genome()
```

--------------------------------

### Setup Data Directories

Source: https://bioconductor.org/packages/release/bioc/vignettes/SpaceMarkers/inst/doc/SpaceMarkers_vignette.html

Initialize the data directory and define URLs for Visium breast cancer datasets.

```R
data_dir <- "visiumBrCA"
unlink(file.path(data_dir), recursive = TRUE)
dir.create(data_dir,showWarnings = FALSE)
main_10xlink <- "https://cf.10xgenomics.com/samples/spatial-exp/1.3.0"
counts_folder <- "Visium_Human_Breast_Cancer"
counts_file <- "Visium_Human_Breast_Cancer_filtered_feature_bc_matrix.h5"
counts_url<-paste(c(main_10xlink,counts_folder,counts_file), collapse = "/")
sp_folder <- "Visium_Human_Breast_Cancer"
sp_file <- "Visium_Human_Breast_Cancer_spatial.tar.gz"
sp_url<-paste(c(main_10xlink,sp_folder,sp_file),collapse = "/")
```

--------------------------------

### Run CellScape Examples

Source: https://bioconductor.org/packages/release/bioc/vignettes/cellscape/inst/doc/cellscape_vignette.html

Execute the built-in package examples to verify installation and view sample data.

```R
example("cellscape")
```

--------------------------------

### Bowtie Build Usage Example

Source: https://bioconductor.org/packages/release/bioc/vignettes/Rbowtie/inst/doc/Rbowtie-Overview.html

Example output showing the command-line usage for bowtie2-build, indicating the expected arguments for reference input and output base name.

```text
##  [1] "Usage: bowtie2-build-s [options]* <reference_in> <ebwt_outfile_base>"            
##  [2]    "    reference_in            comma-separated list of files with ref sequences"    
```

--------------------------------

### Install ppcseq Package

Source: https://bioconductor.org/packages/release/bioc/html/ppcseq.html

To install this package, start R (version "4.5") and enter the following commands. Ensure BiocManager is installed first.

```r
if (!require("BiocManager", quietly = TRUE))
    install.packages("BiocManager")

BiocManager::install("ppcseq")
```

--------------------------------

### Load biotmle and dependencies

Source: https://bioconductor.org/packages/release/bioc/vignettes/biotmle/inst/doc/exposureBiomarkers.html

Initializes the environment by loading necessary libraries and the example dataset.

```R
library(dplyr)
library(biotmle)
library(biotmleData)
library(BiocParallel)
library(SuperLearner)
library(SummarizedExperiment, quietly=TRUE)
data(illuminaData)
set.seed(13847)
```

--------------------------------

### Install beadarray package

Source: https://bioconductor.org/packages/release/bioc/html/beadarray.html

To install this package, start R (version "4.5") and enter the following commands. Ensure BiocManager is installed first.

```r
if (!require("BiocManager", quietly = TRUE))
    install.packages("BiocManager")

BiocManager::install("beadarray")
```

--------------------------------

### Load and Prepare Example BAM File

Source: https://bioconductor.org/packages/release/bioc/vignettes/uncoverappLib/inst/doc/uncoverappLib.html

Locates an example BAM file and writes its path to a list file for use in the application.

```R
bam_example <- system.file("extdata", "example_POLG.bam", package = "uncoverappLib")

print(bam_example)
#> [1] "/tmp/Rtmp4ootG1/Rinst3d3d8ed395d8a/uncoverappLib/extdata/example_POLG.bam"

write.table(bam_example, file= "./bam.list", quote= FALSE, row.names = FALSE, 
            col.names = FALSE)
```

--------------------------------

### Install sccomp and dependencies

Source: https://bioconductor.org/packages/release/bioc/vignettes/sccomp/inst/doc/introduction.html

Installation steps for sccomp via Bioconductor or GitHub, including the required cmdstanr setup.

```R
if (!requireNamespace("BiocManager")) install.packages("BiocManager")

# Step 1
BiocManager::install("sccomp")

# Step 2
install.packages("cmdstanr", repos = c("https://stan-dev.r-universe.dev/", getOption("repos")))

# Step 3
cmdstanr::check_cmdstan_toolchain(fix = TRUE) # Just checking system setting
cmdstanr::install_cmdstan()
```

```R
# Step 1
devtools::install_github("MangiolaLaboratory/sccomp")

# Step 2
install.packages("cmdstanr", repos = c("https://stan-dev.r-universe.dev/", getOption("repos")))

# Step 3
cmdstanr::check_cmdstan_toolchain(fix = TRUE) # Just checking system setting
cmdstanr::install_cmdstan()
```

--------------------------------

### Initialize Oscope Environment

Source: https://bioconductor.org/packages/release/bioc/vignettes/Oscope/inst/doc/Oscope_vignette.R

Load the package and set up the document style.

```R
BiocStyle::latex()
```

```R
library(Oscope)
```

--------------------------------

### Get PureCN Script Path

Source: https://bioconductor.org/packages/release/bioc/vignettes/PureCN/inst/doc/Quick.html

Start an R session to get the path to the PureCN command line scripts.

```r
system.file("extdata", package = "PureCN")
```

--------------------------------

### Load example data

Source: https://bioconductor.org/packages/release/bioc/vignettes/chromVAR/inst/doc/Introduction.html

Load the pre-packaged example dataset into the workspace.

```R
data(example_counts, package = "chromVAR")
head(example_counts)
```

--------------------------------

### Copy Example Dataset

Source: https://bioconductor.org/packages/release/bioc/vignettes/VegaMC/inst/doc/VegaMC.R

Copies the breast_Affy500K.txt example file from the package installation directory to the current working directory.

```R
file.copy(system.file("example/breast_Affy500K.txt",
    package="VegaMC"),".")
```

--------------------------------

### Setup Reproducible Environment

Source: https://bioconductor.org/packages/release/bioc/vignettes/zFPKM/inst/doc/zFPKM.R

Configures global options and loads necessary libraries for the analysis.

```R
## ----reproducible_settings, echo=FALSE----------------------------------------
rm(list=ls())
set.seed(8675309)
options(stringsAsFactors=FALSE)
library(printr)

knitr::opts_chunk$set(message=FALSE, fig.align="center", fig.width=8, fig.height=6)
```

--------------------------------

### Install BiocManager and IRanges Package

Source: https://bioconductor.org/packages/release/bioc/vignettes/IRanges/inst/doc/IRangesOverview.R

Installs the BiocManager package if not already present, and then uses it to install the IRanges package. This is a common setup step for using Bioconductor packages.

```R
## if (!require("BiocManager"))
##     install.packages("BiocManager")
## BiocManager::install("IRanges")
```

--------------------------------

### Reference Peak Directory Setup

Source: https://bioconductor.org/packages/release/bioc/vignettes/TCseq/inst/doc/TCseq.R

Example of setting up a reference directory for peak files.

```R
## dir <- dir.peaks
## gf <- peakreference(dir = dir, pattern = "narrowpeaks")
```

--------------------------------

### Get Start Positions from IRangesList

Source: https://bioconductor.org/packages/release/bioc/vignettes/IRanges/inst/doc/IRangesOverview.R

Extracts the start positions from each IRanges object within an IRangesList. The output is a list where each element corresponds to the start positions of a range set.

```R
start(rl)
```