### Found Starting Sequence Example

Source: https://github.com/rrwick/trycycler/wiki/demo_outputs/mediocre_dataset/cluster_1_reconcile_3.txt

This example shows a detected starting sequence, identified as the chromosomal replication initiator protein DnaA. It is followed by a snippet of the sequence itself.

```text
Found starting sequence 0145_A363_RS01345 (chromosomal replication initiator protein DnaA)
  ATGCGAGCTTGGGAAGAGTTCCTTTTGCTTCAAGAAAAAGAAATTGGAGT...
```

--------------------------------

### Install Trycycler Directly from GitHub with Pip

Source: https://github.com/rrwick/trycycler/wiki/Installation

Install Trycycler directly from its GitHub repository using pip. This is a convenient way to get the latest version without cloning the repository.

```bash
pip3 install git+https://github.com/rrwick/Trycycler.git
trycycler --help
```

--------------------------------

### Input Sequences for Partitioning Example

Source: https://github.com/rrwick/trycycler/wiki/How-multiple-sequence-alignment-partitioning-works

These are the example input sequences used to demonstrate the partitioning process.

```plaintext
GGCAGAGCGACGTAAATTACGAGTAAAGGAGGGGAGAGCATTAAGCATGCCTAAACTG
GGCAGAGCGCGACGTAAATTACGAGTAAAAGGAGGGAGGAGCATTAAGCCATGCCTACTG
GGCAGAGCGCGACTAAATTTACGAGTAAAGGAGGGAGGAGCATAGCCATGCCTAAACTG
```

--------------------------------

### Local Installation with Pip (User Install)

Source: https://github.com/rrwick/trycycler/wiki/Installation

Install Trycycler for the current user only, which is useful on shared systems to avoid permission errors. Ensure '~/.local/bin' is in your PATH.

```bash
pip3 install --user git+https://github.com/rrwick/Trycycler.git
```

--------------------------------

### Verify MUSCLE Installation

Source: https://github.com/rrwick/trycycler/wiki/Software-requirements

Run this command to check for MUSCLE installation. If its usage instructions are displayed, the tool is installed.

```bash
muscle
```

--------------------------------

### Complete End-to-End Trycycler Pipeline Example

Source: https://context7.com/rrwick/trycycler/llms.txt

A comprehensive example demonstrating the full Trycycler pipeline from read QC to consensus generation, including assembly with Flye, Miniasm, and Raven, followed by clustering, reconciliation, MSA, partitioning, and consensus steps.

```bash
# Prerequisites: trycycler, filtlong, flye, miniasm, minipolish, raven,
#                any2fasta, medaka, bwa, polypolish, pypolca installed

# ── 0. Read QC ────────────────────────────────────────────────────────────────
filtlong --min_length 1000 --keep_percent 95 raw_reads.fastq.gz > reads.fastq

# ── 1. Subsample ──────────────────────────────────────────────────────────────
trycycler subsample --reads reads.fastq --out_dir read_subsets \
    --count 12 --genome_size 5m --threads 16

# ── 2. Assemble each subset ───────────────────────────────────────────────────
mkdir assemblies
threads=16
for i in 01 04 07 10; do
    flye --nano-hq read_subsets/sample_${i}.fastq --threads $threads --out-dir tmp_${i}
    cp tmp_${i}/assembly.fasta assemblies/assembly_${i}.fasta; rm -r tmp_${i}
done
for i in 02 05 08 11; do
    miniasm_and_minipolish.sh read_subsets/sample_${i}.fastq $threads \
        > assemblies/assembly_${i}.gfa
    any2fasta assemblies/assembly_${i}.gfa > assemblies/assembly_${i}.fasta
done
for i in 03 06 09 12; do
    raven --threads $threads --disable-checkpoints \
        --graphical-fragment-assembly assemblies/assembly_${i}.gfa \
        read_subsets/sample_${i}.fastq > assemblies/assembly_${i}.fasta
done
rm -r read_subsets

# ── 3. Cluster ────────────────────────────────────────────────────────────────
trycycler cluster --assemblies assemblies/*.fasta --reads reads.fastq \
    --out_dir trycycler --threads 16
# → inspect trycycler/contigs.newick, delete bad cluster directories

# ── 4. Reconcile ──────────────────────────────────────────────────────────────
for c in trycycler/cluster_*; do
    trycycler reconcile --reads reads.fastq --cluster_dir "$c" --threads 16
done

# ── 5. MSA ────────────────────────────────────────────────────────────────────
for c in trycycler/cluster_*; do
    trycycler msa --cluster_dir "$c" --threads 16
done

# ── 6. Partition ──────────────────────────────────────────────────────────────
trycycler partition --reads reads.fastq --cluster_dirs trycycler/cluster_* --threads 16

# ── 7. Consensus ──────────────────────────────────────────────────────────────
for c in trycycler/cluster_*; do
    trycycler consensus --cluster_dir "$c" --threads 16
done
cat trycycler/cluster_*/7_final_consensus.fasta > trycycler/consensus.fasta
```

--------------------------------

### Install GCC on Ubuntu

Source: https://github.com/rrwick/trycycler/wiki/Installation

Use this command to install the build-essential package on Ubuntu and related distributions, which includes GCC.

```bash
sudo apt install build-essential
```

--------------------------------

### Install Trycycler from Local Source with Pip

Source: https://github.com/rrwick/trycycler/wiki/Installation

Clone the Trycycler repository and then install it using pip. This method is suitable for development or when you have a local copy of the code.

```bash
git clone https://github.com/rrwick/Trycycler.git
pip3 install ./Trycycler
trycycler --help
```

--------------------------------

### Verify Minimap2 Installation

Source: https://github.com/rrwick/trycycler/wiki/Software-requirements

Execute this command to confirm Minimap2 installation. The tool is correctly installed if its usage instructions are shown.

```bash
minimap2 --help
```

--------------------------------

### Install Trycycler via Conda

Source: https://context7.com/rrwick/trycycler/llms.txt

Recommended installation method using conda, which automatically handles dependencies. Creates a dedicated environment for Trycycler.

```bash
conda create -c bioconda -c conda-forge -n trycycler trycycler
conda activate trycycler

# Or install into the current environment
conda install -c bioconda -c conda-forge trycycler
```

--------------------------------

### Verify R Packages (ape, phangorn)

Source: https://github.com/rrwick/trycycler/wiki/Software-requirements

After starting an R terminal, attempt to load the 'ape' and 'phangorn' packages. If they load without errors, they are installed. Otherwise, use the provided install commands.

```bash
R
```

```R
library(ape)
library(phangorn)
```

```R
install.packages("ape")
install.packages("phangorn")
```

--------------------------------

### Install Trycycler with Pip (Using python3 -m pip)

Source: https://github.com/rrwick/trycycler/wiki/Installation

If 'pip3' is not available and 'pip' is for Python 2, use 'python3 -m pip' to ensure installation with Python 3.

```bash
python3 -m pip install git+https://github.com/rrwick/Trycycler.git
```

--------------------------------

### Verify Miniasm Installation

Source: https://github.com/rrwick/trycycler/wiki/Software-requirements

Run this command to check if Miniasm is installed. Successful installation is indicated by the display of its usage instructions.

```bash
miniasm
```

--------------------------------

### Install GCC on CentOS

Source: https://github.com/rrwick/trycycler/wiki/Installation

Execute this command to install the 'Development Tools' group on CentOS and related distributions, providing GCC and other necessary utilities.

```bash
sudo yum groupinstall "Development Tools"
```

--------------------------------

### Verify Mash Installation

Source: https://github.com/rrwick/trycycler/wiki/Software-requirements

This command verifies the Mash installation. If its usage instructions appear, Mash is installed.

```bash
mash --help
```

--------------------------------

### Example of Sequence Partitioning for MSA

Source: https://github.com/rrwick/trycycler/wiki/How-multiple-sequence-alignment-partitioning-works

Illustrates the input sequences, how they are partitioned, the alignment of these partitions, and the final merged alignment.

```plaintext
Input sequences:
  GGCAGAGCGACGTAAATTACGAGTAAAGGAGGGGAGAGCATTAAGCATGCCTAAACTG
  GGCAGAGCGCGACGTAAATTACGAGTAAAAGGAGGGAGGAGCATTAAGCCATGCCTACTG
  GGCAGAGCGCGACTAAATTTACGAGTAAAGGAGGGAGGAGCATTAGCCATGCCTAAACTG

Partitioned sequences:
  GGCAGAGCGA    CGTAAATTAC  GAGTAAAGGAGGGGAGAGCATTAAGCATGC    CTAAACTG
  GGCAGAGCGCGA  CGTAAATTAC  GAGTAAAAGGAGGGAGGAGCATTAAGCCATGC  CTACTG
  GGCAGAGCGCGA  CTAAATTTAC  GAGTAAAGGAGGGAGGAGCATAGCCATGC     CTAAACTG

Aligned partitions:
  GGCAGAG--CGA  CGTAAA-TTAC  GAGT-AAAGGAGGGGA-GAGCATTAAG-CATGC  CTAAACTG
  GGCAGAGCGCGA  CGTAAA-TTAC  GAGTAAAAGGA-GGGAGGAGCATTAAGCCATGC  CT--ACTG
  GGCAGAGCGCGA  C-TAAATTTAC  GAGT-AAAGGA-GGGAGGAGCAT--AGCCATGC  CTAAACTG

Merged alignments:
  GGCAGAG--CGACGTAAA-TTACGAGT-AAAGGAGGGGA-GAGCATTAAG-CATGCCTAAACTG
  GGCAGAGCGCGACGTAAA-TTACGAGTAAAAGGA-GGGAGGAGCATTAAGCCATGCCT--ACTG
  GGCAGAGCGCGAC-TAAATTTACGAGT-AAAGGA-GGGAGGAGCAT--AGCCATGCCTAAACTG
```

--------------------------------

### Install Trycycler with Conda

Source: https://github.com/rrwick/trycycler/wiki/Installation

Use this command to create a new conda environment named 'trycycler' and install Trycycler. It ensures all dependencies are managed.

```bash
conda create -c bioconda -c conda-forge -n trycycler trycycler
```

--------------------------------

### Install Trycycler with Pip (Using pip instead of pip3)

Source: https://github.com/rrwick/trycycler/wiki/Installation

If 'pip3' is not found, try using 'pip' instead. Ensure that your 'pip' command is associated with Python 3 by checking 'pip --version'.

```bash
pip install git+https://github.com/rrwick/Trycycler.git
```

--------------------------------

### Unsafe k-mer Example (AGGA)

Source: https://github.com/rrwick/trycycler/wiki/How-multiple-sequence-alignment-partitioning-works

Illustrates a k-mer ('AGGA') that is not found uniquely in all sequences, thus not a safe division point.

```html

GGCAGAGCGA    CGTAAATTAC  GAGTAA<b>AGGA</b>GGGGAGAGCATTAAGCATGCCTAAACTG

```

```html

GGCAGAGCGA    CGTAAATTAC  GAGTAA<b>AGGA</b>GGGGAGAGCATTAAGCATGCCTAAACTG
GGCAGAGCGCGA  CGTAAATTAC  GAGTAAA<b>AGGA</b>GGG<b>AGGA</b>GCATTAAGCCATGCCTACTG
GGCAGAGCGCGA  CTAAATTTAC  GAGTAA<b>AGGA</b>GGG<b>AGGA</b>GCATAGCCATGCCTAAACTG
                          --------------------
                               lookahead

```

--------------------------------

### Generate Assemblies with Flye, Miniasm+Minipolish, and Raven

Source: https://github.com/rrwick/trycycler/wiki/Generating-assemblies

This script demonstrates how to run three different assemblers (Flye, Miniasm+Minipolish, and Raven) on subsampled read sets to generate multiple assemblies. It specifies the number of threads and organizes the output into FASTA and GFA files. Ensure the 'threads' variable is set appropriately for your system.

```bash
threads=16  # change as appropriate for your system
mkdir assemblies

flye --nano-hq read_subsets/sample_01.fastq --threads "$threads" --out-dir assembly_01 && cp assembly_01/assembly.fasta assemblies/assembly_01.fasta && cp assembly_01/assembly_graph.gfa assemblies/assembly_01.gfa && rm -r assembly_01
miniasm_and_minipolish.sh read_subsets/sample_02.fastq "$threads" > assemblies/assembly_02.gfa && any2fasta assemblies/assembly_02.gfa > assemblies/assembly_02.fasta
raven --threads "$threads" --disable-checkpoints --graphical-fragment-assembly assemblies/assembly_03.gfa read_subsets/sample_03.fastq > assemblies/assembly_03.fasta

flye --nano-hq read_subsets/sample_04.fastq --threads "$threads" --out-dir assembly_04 && cp assembly_04/assembly.fasta assemblies/assembly_04.fasta && cp assembly_04/assembly_graph.gfa assemblies/assembly_04.gfa && rm -r assembly_04
miniasm_and_minipolish.sh read_subsets/sample_05.fastq "$threads" > assemblies/assembly_05.gfa && any2fasta assemblies/assembly_05.gfa > assemblies/assembly_05.fasta
raven --threads "$threads" --disable-checkpoints --graphical-fragment-assembly assemblies/assembly_06.gfa read_subsets/sample_06.fastq > assemblies/assembly_06.fasta

flye --nano-hq read_subsets/sample_07.fastq --threads "$threads" --out-dir assembly_07 && cp assembly_07/assembly.fasta assemblies/assembly_07.fasta && cp assembly_07/assembly_graph.gfa assemblies/assembly_07.gfa && rm -r assembly_07
miniasm_and_minipolish.sh read_subsets/sample_08.fastq "$threads" > assemblies/assembly_08.gfa && any2fasta assemblies/assembly_08.gfa > assemblies/assembly_08.fasta
raven --threads "$threads" --disable-checkpoints --graphical-fragment-assembly assemblies/assembly_09.gfa read_subsets/sample_09.fastq > assemblies/assembly_09.fasta

flye --nano-hq read_subsets/sample_10.fastq --threads "$threads" --out-dir assembly_10 && cp assembly_10/assembly.fasta assemblies/assembly_10.fasta && cp assembly_10/assembly_graph.gfa assemblies/assembly_10.gfa && rm -r assembly_10
miniasm_and_minipolish.sh read_subsets/sample_11.fastq "$threads" > assemblies/assembly_11.gfa && any2fasta assemblies/assembly_11.gfa > assemblies/assembly_11.fasta
raven --threads "$threads" --disable-checkpoints --graphical-fragment-assembly assemblies/assembly_12.gfa read_subsets/sample_12.fastq > assemblies/assembly_12.fasta
```

--------------------------------

### Verify External Dependencies for Pip Installation

Source: https://context7.com/rrwick/trycycler/llms.txt

Checks if essential external tools required for pip installation are available in the system's PATH.

```bash
miniasm          # long-read assembler used for genome size estimation
minimap2 --help  # sequence alignment
mash --help      # k-mer distance estimation
muscle           # multiple sequence alignment (use v3.8, not v5)
R -e "library(ape); library(phangorn)"  # phylogenetic tree generation
```

--------------------------------

### Generate Input Assemblies with Multiple Assemblers

Source: https://context7.com/rrwick/trycycler/llms.txt

Demonstrates generating input assemblies for Trycycler using different assemblers (Flye, Miniasm+Minipolish, Raven) on distinct read subsets. Results are collected into a single directory.

```bash
threads=16
mkdir assemblies

# Flye (Nanopore HQ reads) — subsets 01, 04, 07, 10
for i in 01 04 07 10; do
    flye --nano-hq read_subsets/sample_${i}.fastq --threads "$threads" --out-dir flye_tmp_${i}
    cp flye_tmp_${i}/assembly.fasta assemblies/assembly_${i}.fasta
    rm -r flye_tmp_${i}
done

# Miniasm + Minipolish — subsets 02, 05, 08, 11
for i in 02 05 08 11; do
    miniasm_and_minipolish.sh read_subsets/sample_${i}.fastq "$threads" > assemblies/assembly_${i}.gfa
    any2fasta assemblies/assembly_${i}.gfa > assemblies/assembly_${i}.fasta
done

# Raven — subsets 03, 06, 09, 12
for i in 03 06 09 12; do
    raven --threads "$threads" --disable-checkpoints \
          --graphical-fragment-assembly assemblies/assembly_${i}.gfa \
          read_subsets/sample_${i}.fastq > assemblies/assembly_${i}.fasta
done

# Result: 12 FASTA files, one per subset
ls assemblies/*.fasta
# assemblies/assembly_01.fasta ... assemblies/assembly_12.fasta

# Subsampled reads are no longer needed
rm -r read_subsets
```

--------------------------------

### Run Trycycler Partition with Glob Expansion

Source: https://github.com/rrwick/trycycler/wiki/Partitioning-reads

Use this command to partition reads when your cluster directories are named sequentially and can be matched with a glob pattern. Ensure `reads.fastq` contains your long reads.

```bash
trycycler partition --reads reads.fastq --cluster_dirs trycycler/cluster_*
```

--------------------------------

### Install Trycycler in Current Conda Environment

Source: https://github.com/rrwick/trycycler/wiki/Installation

Use this command to install Trycycler into your currently active conda environment. This is useful if you don't want to create a new environment.

```bash
conda install -c bioconda -c conda-forge trycycler
```

--------------------------------

### Automate Trycycler MSA, Partition, and Consensus

Source: https://github.com/rrwick/trycycler/wiki/Mediocre-dataset-analysis

Use these bash loops to run the MSA, partition, and consensus steps for Trycycler genomes. This approach is reusable for any number of clusters.

```bash
for c in trycycler/cluster_*; do
    trycycler msa --cluster_dir "$c"
done
```

```bash
trycycler partition --reads reads.fastq.gz --cluster_dirs trycycler/cluster_*
```

```bash
for c in trycycler/cluster_*; do
    trycycler consensus --cluster_dir "$c"
done
```

```bash
cat trycycler/cluster_*/7_final_consensus.fasta > assembly.fasta
```

--------------------------------

### Filter and Polish with Polypolish

Source: https://context7.com/rrwick/trycycler/llms.txt

Filters BWA alignments and then polishes the assembly using Polypolish. Requires Polypolish to be installed.

```bash
polypolish filter --in1 aln_1.sam --in2 aln_2.sam --out1 f1.sam --out2 f2.sam
polypolish polish trycycler/medaka_consensus.fasta f1.sam f2.sam > polypolish.fasta
```

--------------------------------

### Run Multiple Assemblers with Subsampled Reads

Source: https://github.com/rrwick/trycycler/wiki/Generating-assemblies

Use this command to initiate assemblies with multiple tools on subsampled read sets. This approach is recommended for maximum thoroughness in the assembly process.

```bash
trycycler -t 16 -o 24 -a 8 -c 10 -x 1000000000 -p 1000000000 -s 1000000000 -m 1000000000 -i 1000000000 -d 1000000000 -g 1000000000 -l 1000000000 -r 1000000000 -e 1000000000 -f 1000000000 -b 1000000000 -n 1000000000 -u 1000000000 -v 1000000000 -w 1000000000 -z 1000000000 -k 1000000000 -j 1000000000 -q 1000000000 -y 1000000000 -h 1000000000 -P 1000000000 -N 1000000000 -R 1000000000 -E 1000000000 -F 1000000000 -B 1000000000 -U 1000000000 -V 1000000000 -W 1000000000 -Z 1000000000 -K 1000000000 -J 1000000000 -Q 1000000000 -Y 1000000000 -H 1000000000 -O 1000000000 -I 1000000000 -X 1000000000 -C 1000000000 -G 1000000000 -L 1000000000 -S 1000000000 -T 1000000000 -D 1000000000 -A 1000000000 -M 1000000000 -P 1000000000 -N 1000000000 -R 1000000000 -E 1000000000 -F 1000000000 -B 1000000000 -U 1000000000 -V 1000000000 -W 1000000000 -Z 1000000000 -K 1000000000 -J 1000000000 -Q 1000000000 -Y 1000000000 -H 1000000000 -O 1000000000 -I 1000000000 -X 1000000000 -C 1000000000 -G 1000000000 -L 1000000000 -S 1000000000 -T 1000000000 -D 1000000000 -A 1000000000 -M 1000000000 --flye --miniasm --raven --canu --necat --nextdenovo
```

--------------------------------

### Assemble with Flye

Source: https://github.com/rrwick/trycycler/wiki/Generating-assemblies

Use Flye for assembly, specifically with --nano-hq for high-quality Nanopore reads. Copies the assembly and graph files to the assemblies directory.

```bash
flye --nano-hq read_subsets/sample_"$i".fastq --threads "$threads" --out-dir flye_temp
cp flye_temp/assembly.fasta assemblies/assembly_"$i".fasta
cp flye_temp/assembly_graph.gfa assemblies/assembly_"$i".gfa
rm -r flye_temp
```

--------------------------------

### Run Pypolca for Final Polishing

Source: https://context7.com/rrwick/trycycler/llms.txt

Applies Pypolca for final polishing of the assembly using the Polypolish output and paired-end reads. Ensure Pypolca is installed.

```bash
pypolca run --careful -a polypolish.fasta -1 reads_1.fastq.gz -2 reads_2.fastq.gz \
    -t 16 -o pypolca
cp pypolca/pypolca_corrected.fasta final_assembly.fasta
```

--------------------------------

### Index and Align with BWA

Source: https://context7.com/rrwick/trycycler/llms.txt

Indexes the Medaka consensus FASTA file and aligns paired-end FASTQ reads using BWA. Ensure BWA is installed and indexed.

```bash
bwa index trycycler/medaka_consensus.fasta
bwa mem -t 16 -a trycycler/medaka_consensus.fasta reads_1.fastq.gz > aln_1.sam
bwa mem -t 16 -a trycycler/medaka_consensus.fasta reads_2.fastq.gz > aln_2.sam
```

--------------------------------

### Run Trycycler Partition

Source: https://github.com/rrwick/trycycler/wiki/Great-dataset-analysis

Partitions reads across cluster directories. Requires input reads and a pattern matching all cluster directories. This step helps in assigning reads to their respective clusters.

```bash
trycycler partition --reads reads.fastq.gz --cluster_dirs trycycler/cluster_*
```

--------------------------------

### Polypolish + Pypolca (Illumina Short-Read Polishing)

Source: https://context7.com/rrwick/trycycler/llms.txt

Performs short-read polishing using Polypolish and Pypolca. This involves read QC with fastp, alignment and filtering with BWA and Polypolish, and a final polishing pass with Pypolca.

```bash
# Step 1: Illumina read QC
fastp \
    --in1 reads_1.fastq.gz --in2 reads_2.fastq.gz \
    --out1 1.fastq.gz --out2 2.fastq.gz \
    --unpaired1 u.fastq.gz --unpaired2 u.fastq.gz

# Step 2: Polypolish — align both read pairs, filter, polish
bwa index trycycler/consensus.fasta
bwa mem -t 16 -a trycycler/consensus.fasta reads_1.fastq.gz > alignments_1.sam
bwa mem -t 16 -a trycycler/consensus.fasta reads_2.fastq.gz > alignments_2.sam
polypolish filter \
    --in1 alignments_1.sam --in2 alignments_2.sam \
    --out1 filtered_1.sam --out2 filtered_2.sam
polypolish polish trycycler/consensus.fasta filtered_1.sam filtered_2.sam > polypolish.fasta

# Step 3: Pypolca — additional short-read polishing pass
pypolca run --careful \
    -a polypolish.fasta \
    -1 reads_1.fastq.gz -2 reads_2.fastq.gz \
    -t 16 -o pypolca
cp pypolca/pypolca_corrected.fasta final_assembly.fasta
```

--------------------------------

### Read Alignment Example (G Variant)

Source: https://github.com/rrwick/trycycler/wiki/How-variants-are-chosen-for-the-consensus-sequence

Illustrates read alignment to the 'G' version of a sequence chunk, showing individual read scores and the resulting alignment.

```plaintext
                                                read 1:       GAAAAGCA-T  score= 8
                                                read 2:      CGAAAAGCAC   score=10
                                                read 3:  GCCTCG-AAACCACT  score=11
                                                read 4: TG-CTCGAAAAGCA    score=12
------------------------------------------------------------------------
GGAGGAGCTTTTTCGCCGCAGTCAACATAGCGTCTGAAAACGTGTATCATAAATCTTGCCTCGAAAAGCACT
                                                                   ↑
```

--------------------------------

### Read Alignment Example (C Variant)

Source: https://github.com/rrwick/trycycler/wiki/How-variants-are-chosen-for-the-consensus-sequence

Illustrates read alignment to the 'C' version of a sequence chunk, showing individual read scores and the resulting alignment.

```plaintext
                                                read 1:       GAAAAGCA-T  score= 6
                                                read 2:      CGAAAAGCAC   score= 8
                                                read 3:  GCCTCG-AAACCACT  score=13
                                                read 4: TG-CTCGAAAAGCA    score=10
------------------------------------------------------------------------
GGAGGAGCTTTTTCGCCGCAGTCAACATAGCGTCTGAAAACGTGTATCATAAATCTTGCCTCGAAAACCACT
                                                                   ↑
```

--------------------------------

### Download RefSeq Genomes

Source: https://github.com/rrwick/trycycler/wiki/Starting-sequences-for-circular-replicons

Use ncbi-genome-download to fetch all completed RefSeq prokaryotic genomes in GenBank format. This is the first step in identifying common starting genes.

```bash
ncbi-genome-download -p 4 --assembly-level complete bacteria,archaea
```

--------------------------------

### Run Medaka Consensus and Cleanup

Source: https://context7.com/rrwick/trycycler/llms.txt

This snippet runs Medaka for consensus generation on clustered reads and cleans up intermediate files. Ensure Medaka is installed and models are available.

```bash
for c in trycycler/cluster_*; do
    medaka_consensus -i "$c"/4_reads.fastq -d "$c"/7_final_consensus.fasta \
        -o "$c"/medaka -m r941_min_sup_g507 -t 12
    mv "$c"/medaka/consensus.fasta "$c"/8_medaka.fasta
    rm -r "$c"/medaka "$c"/*.fai "$c"/*.mmi
done
cat trycycler/cluster_*/8_medaka.fasta > trycycler/medaka_consensus.fasta
```