### Install Hybkit using SetupTools Source: https://github.com/rennelab/hybkit/blob/master/docs/index.md After cloning or downloading, install the package using python setuptools. ```bash $ python setup.py install ``` -------------------------------- ### Install Pytest and Run Tests Source: https://github.com/rennelab/hybkit/blob/master/docs/index.md Install pytest and run the unit test suite from the root directory of the hybkit package. ```bash $ pip install pytest $ pytest ``` -------------------------------- ### Example .hyb format line Source: https://github.com/rennelab/hybkit/blob/master/docs/source/specification.md A sample line demonstrating the tab-delimited structure of a .hyb file. ```default 2407_718 ATCACATTGCCAGGGATTTCCAATCCCCAACAATGTGAAAACGGCTGTC . MIMAT0000078_MirBase_miR-23a_microRNA 1 21 1 21 0.0027 ENSG00000188229_ENST00000340384_TUBB2C_mRNA 23 49 1181 1207 1.2e-06 ``` -------------------------------- ### Install Hybkit via Python PIP Source: https://github.com/rennelab/hybkit/blob/master/docs/index.md Install the hybkit package and its dependencies using pip, the Python package installer. This is the recommended installation method. ```bash $ python3 -m pip install hybkit ``` -------------------------------- ### Run hyb_check system calls Source: https://github.com/rennelab/hybkit/blob/master/docs/source/toolkit/hyb_check.md Examples of executing hyb_check with single or multiple input files and optional fold files. ```default hyb_check -i my_file_1.hyb -f my_file_1.vienna hyb_check -i my_file_1.hyb my_file_2.hyb -f my_file_1.vienna \ my_file_2.vienna -v --custom_flags myflag ``` -------------------------------- ### CT File Format Example Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.md Example of the .ct file format used by UNAFold and other packages. It includes sequence information, base pairing details, and energy values. ```default 41 dG = -8 dH = -93.9 seq1_name-seq2_name 1 A 0 2 0 1 0 0 2 G 1 3 0 2 0 0 ... ... ... 40 G 39 41 11 17 39 41 41 T 40 0 10 18 40 0 ``` -------------------------------- ### Execute hyb_analyze system calls Source: https://github.com/rennelab/hybkit/blob/master/docs/source/toolkit/hyb_analyze.md Examples of running the hyb_analyze utility from the command line with different input formats and plot configurations. ```bash $ hyb_analyze -a fold -i my_file_1.hyb -f my_file_1.vienna
$ hyb_analyze -a fold -i my_file_2.hyb -f my_file_2.ct \ --make_plots False ``` -------------------------------- ### Combine type and miRNA evaluation Source: https://github.com/rennelab/hybkit/blob/master/docs/source/toolkit/hyb_eval.md Example of running both type and miRNA evaluations in a single command. ```bash $ hyb_eval -t type mirna -i my_file_1.hyb \ --type_method string_match \ --type_parameters my_parameters_file.csv \ --allow_unknown_seg_types \ --mirna_types miRNA kshv-miRNA ``` -------------------------------- ### Hyb Record Example Line Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.md An example string representing a single line in the hyb-format file, containing detailed information about a chimeric RNA sequence read. ```text 2407_718 ATCACATTGCCAGGGATTTCCAATCCCCAACAATGTGAAAACGGCTGTC . MIMAT0000078_MirBase_miR-23a_microRNA 1 21 1 21 0.0027 ENSG00000188229_ENST00000340384_TUBB2C_mRNA 23 49 1181 1207 1.2e-06 ``` -------------------------------- ### Vienna File Format Example Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.md Example of the .vienna file format used by the ViennaRNA package. It includes a sequence identifier, the nucleotide sequence, and its dot-bracket fold representation with an associated energy value. ```default 34_151138_MIMAT0000076_MirBase_miR-21_microRNA_1_19-... TAGCTTATCAGACTGATGTTAGCTTATCAGACTGATG .....((((((.((((((......)))))).)))))) (-11.1) ``` -------------------------------- ### Static vs. Dynamic FoldRecord Alignment Example Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.md Illustrates the difference between static and dynamic FoldRecord sequences based on overlapping and gapped alignments. Static sequences match HybRecord.seq exactly, while dynamic sequences are reconstructed from aligned regions. ```default Static: seg1: 1111111111111111111111 seg2: 222222222222222222222 seq: TAGCTTATCAGACTGATGTTTTAGCTTATCAGACTGATG Dynamic: seg1: 1111111111111111111111 seg2: 222222222222222222222 seq: TAGCTTATCAGACTGATGTTTTTTTTAGCTTATCAGACTGATG ``` ```default Static: seg1: 1111111111111111 seg2: 222222222222222222 seq: TTAGCTTATCAGACTGATGTTAGCTTATCAGACTGATG Dynamic: seg1: 1111111111111111 seg2: 222222222222222222 seq: AGCTTATCAGACTGATTAGCTTATCAGACTGATG ``` -------------------------------- ### Match ANY Filtering Criteria (Default Behavior) Source: https://github.com/rennelab/hybkit/blob/master/docs/source/toolkit/hyb_filter.md The default filter mode is 'any', meaning records are included if they match at least one of the specified criteria. This example outputs records with a segtype of either 'miRNA' or 'lncRNA'. ```bash hyb_filter -i my_file_1.hyb --filter_mode any \ --filter seg_type miRNA \ --filter_2 seg_type lncRNA ``` -------------------------------- ### Install Hybkit via Conda Source: https://github.com/rennelab/hybkit/blob/master/docs/index.md Install the hybkit package and dependencies from the Bioconda channel using the conda package manager. ```bash $ conda install -c bioconda hybkit ``` -------------------------------- ### Configure Automatic Output Naming Source: https://github.com/rennelab/hybkit/blob/master/docs/source/toolkit/hyb_analyze.md Demonstrates default output naming behavior and how to customize the output directory and suffix. ```default hyb_script -i PATH_TO/MY_FILE_1.HYB [...] --> OUT_DIR/MY_FILE_1_ADDSUFFIX.HYB ``` ```default hyb_script -i PATH_TO/MY_FILE_1.HYB [...] --out_dir MY_OUT_DIR --> MY_OUT_DIR/MY_FILE_1_ADDSUFFIX.HYB ``` ```default hyb_script -i PATH_TO/MY_FILE_1.HYB [...] --out_suffix MY_SUFFIX --> OUT_DIR/MY_FILE_1_MY_SUFFIX.HYB #OR hyb_script -i PATH_TO/MY_FILE_1.HYB [...] --out_suffix MY_SUFFIX.HYB --> OUT_DIR/MY_FILE_1_MY_SUFFIX.HYB ``` -------------------------------- ### Create and Parse HybRecord Source: https://context7.com/rennelab/hybkit/llms.txt Demonstrates creating a HybRecord from scratch and parsing one from a hyb-format line. Accesses record properties and converts back to a line. ```python import hybkit # Create a HybRecord from scratch seg1_props = { 'ref_name': 'MIMAT0000078_MirBase_miR-23a_microRNA', 'read_start': 1, 'read_end': 21, 'ref_start': 1, 'ref_end': 21, 'score': 0.0027 } seg2_props = { 'ref_name': 'ENSG00000188229_ENST00000340384_TUBB2C_mRNA', 'read_start': 23, 'read_end': 49, 'ref_start': 1181, 'ref_end': 1207, 'score': 1.2e-06 } hyb_record = hybkit.HybRecord( id='2407_718', seq='ATCACATTGCCAGGGATTTCCAATCCCCAACAATGTGAAAACGGCTGTC', energy='-7.3', seg1_props=seg1_props, seg2_props=seg2_props ) # Parse from a hyb-format line (typical usage) line = "2407_718\tATCACATTGCCAGGGATTTCCAATCCCCAACAATGTGAAAACGGCTGTC\t.\tMIMAT0000078_MirBase_miR-23a_microRNA\t1\t21\t1\t21\t0.0027\tENSG00000188229_ENST00000340384_TUBB2C_mRNA\t23\t49\t1181\t1207\t1.2e-06" hyb_record = hybkit.HybRecord.from_line(line) # Access record properties print(f"ID: {hyb_record.id}") print(f"Sequence: {hyb_record.seq}") print(f"Length: {len(hyb_record)}") print(f"Seg1 Reference: {hyb_record.seg1_props['ref_name']}") print(f"Seg2 Reference: {hyb_record.seg2_props['ref_name']}") # Convert back to hyb format line output_line = hyb_record.to_line() ``` -------------------------------- ### Automate analysis with Python Source: https://context7.com/rennelab/hybkit/llms.txt A complete Python workflow for configuring settings, defining type matching, and initializing analysis. ```python #!/usr/bin/env python3 import os import hybkit # Configuration input_files = ['sample1.hyb', 'sample2.hyb', 'sample3.hyb'] output_dir = 'analysis_output' os.makedirs(output_dir, exist_ok=True) # Configure miRNA types (include custom viral miRNAs) hybkit.settings.HybRecord_settings['mirna_types'] = ['microRNA', 'miRNA', 'KSHV-miRNA'] # Set up type finding with string matching legend_file = 'string_match_legend.csv' match_params = hybkit.HybRecord.TypeFinder.make_string_match_params(legend_file) hybkit.HybRecord.TypeFinder.set_method('string_match', match_params) # Types to exclude (QC filtering) exclude_types = ['rRNA', 'mitoch-rRNA'] # Initialize combined analysis combined_analysis = hybkit.analysis.Analysis( analysis_types=['type', 'mirna', 'target'], name='Combined_Analysis' ) ``` -------------------------------- ### Create HybRecord with Basic Information Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.md Initialize a HybRecord object with an ID, sequence, and optional energy value. This is a basic way to create a record. ```python hyb_record_1 = hybkit.HybRecord('1_100', 'ACTG') hyb_record_2 = hybkit.HybRecord('2_107', 'CTAG', '-7.3') hyb_record_3 = hybkit.HybRecord('3_295', 'CTTG', energy='-10.3') ``` -------------------------------- ### Construct HybRecord from Line Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.md Demonstrates the preferred method for creating a HybRecord object by parsing a single line from a hyb-format file using the from_line() constructor. ```python # line = "2407_718\tATC..." hyb_record = hybkit.HybRecord.from_line(line) ``` -------------------------------- ### GET /hybrecord/to_fields_header Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.md Returns a list of the fields in a HybRecord object. ```APIDOC ## GET /hybrecord/to_fields_header ### Description Return a list of the fields in a HybRecord object for use with the to_fields() method. ### Method GET ### Response #### Success Response (200) - **fields** (list) - List of field names: id, seq, energy, seg1_ref_name, seg1_read_start, seg1_read_end, seg1_ref_start, seg1_ref_end, seg1_score, seg2_ref_name, seg2_read_start, seg2_read_end, seg2_ref_start, seg2_ref_end, seg2_score, flags. ``` -------------------------------- ### GET /hybrecord/to_csv_header Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.md Returns a comma-separated string representation of the fields in the record. ```APIDOC ## GET /hybrecord/to_csv_header ### Description Return a comma-separated string representation of the fields in the record for use with the to_csv() method. ### Method GET ### Parameters #### Query Parameters - **newline** (bool) - Optional - If True, end the returned string with a newline. ### Response #### Success Response (200) - **header** (string) - Comma-separated string of field names. ``` -------------------------------- ### ViennaFile Constructor Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.md Initializes a new ViennaFile instance to wrap a Vienna-format file. ```APIDOC ## ViennaFile Constructor ### Description Initializes the ViennaFile wrapper to process Vienna-format file lines as FoldRecord objects. ### Parameters - **seq_type** (str) - Optional - Type of FoldRecord to return: 'static' or 'dynamic'. - **error_mode** (str) - Optional - Error handling mode: 'raise', 'warn_return', or 'return'. - **from_file_like** (bool) - Optional - If True, treats the first argument as a file-like object. ``` -------------------------------- ### Method: open() Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.md Class method to open a path to a text file and return a file object. ```APIDOC ## Method open() ### Description Open a path to a text file and return a relevant file object. ### Parameters - **path** (str) - Required - Path to file to open. - **seq_type** (str) - Optional - Type of FoldRecord to return. - **error_mode** (str) - Optional - Error handling mode. ### Response - **Return Type** (HybFile) - The opened file object. ``` -------------------------------- ### Configure FoldFile Settings Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.settings.md Placeholder for FoldFile settings information. Currently an empty dictionary, indicating default or no specific configurations are defined here. ```python hybkit.settings.FoldFile_settings_info = { } ``` -------------------------------- ### Find Segment Type Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.type_finder.md Example of the internal call structure used by the find method to determine segment types. ```default seg_type = :meth:`TypeFinder.find_custom_method`(seg_props, :attr`TypeFinder.params`) ``` -------------------------------- ### Perform miRNA evaluation with hyb_eval Source: https://github.com/rennelab/hybkit/blob/master/docs/source/toolkit/hyb_eval.md Examples of using the miRNA evaluation mode to identify miRNA properties within hybrids. ```bash $ hyb_eval -t mirna -i my_file_1.hyb ``` ```bash $ hyb_eval -t mirna -i my_file_1.hyb -f my_file_1.vienna ``` ```bash $ hyb_eval -t mirna -i my_file_1.hyb my_vile_2.hyb \ -f my_file_1.vienna my_file_2.vienna \ --mirna_types miRNA kshv-miRNA ``` -------------------------------- ### HybFile Class Constructor Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.md Initializes a HybFile object, which wraps a hyb-format text file and returns entries as HybRecord objects. ```APIDOC ## hybkit.HybFile(path: str, *args: Any, hybformat_id: bool | None = None, hybformat_ref: bool | None = None, from_file_like: bool = False, **kwargs: Any) ### Description Wrapper for a hyb-format text file which returns entries (lines) as HybRecord objects. ### Parameters #### Path Parameter - **path** (str) - Required - Path to text file to open as hyb-format file. #### Other Parameters - **\*args** - Arguments passed to `open()` function to open a text file for reading/writing. - **hybformat_id** (bool, optional) - If `True`, during parsing of lines read count information from identifier in `_` format. Defaults to value in `settings['hybformat_id']`. - **hybformat_ref** (bool, optional) - If `True`, during parsing of lines read additional record information from identifier in `___` format. Defaults to value in `settings['hybformat_ref']`. - **from_file_like** (bool, optional) - If `True`, the first argument is treated as a file-like object (such as io.StringIO or gzip.GzipFile) and the remaining positional arguments are ignored. (Default False) - **\*\*kwargs** - Keyword arguments passed to `open()` function to open a text file for reading/writing. ### Variables - **hybformat_id** (bool) - Read count information from identifier during line parsing - **hybformat_ref** (bool) - Read type information from reference name during line parsing - **fh** (file) - Underlying file handle for the HybFile object. #### settings *= {'hybformat_id': False, 'hybformat_ref': False}* Class-level settings. See `hybkit.settings.HybFile_settings_info` for descriptions. ``` -------------------------------- ### Perform type evaluation with hyb_eval Source: https://github.com/rennelab/hybkit/blob/master/docs/source/toolkit/hyb_eval.md Examples of using the type evaluation mode to assign segment types to hybrid records. ```bash $ hyb_eval -t type -i my_file_1.hyb ``` ```bash $ hyb_eval -t type -i my_file_1.hyb -f my_file_1.vienna ``` ```bash $ hyb_eval -t type \ -i my_file_1.hyb my_file_2.hyb \ -f my_file_1.vienna my_file_2.vienna \ --type_method string_match \ --type_parameters my_parameters_file.csv \ --allow_unknown_seg_types ``` -------------------------------- ### Direct HybRecord Construction Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.md Illustrates how to directly construct a HybRecord object by providing the minimum required data: the sequence and its identifier. Other parameters are optional. ```python # Example of direct construction (not shown in source, but implied by class signature) # hyb_record = hybkit.HybRecord(id='example_id', seq='ATCGATCG') pass ``` -------------------------------- ### open Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.md Class method to open a path to a text file and return a ViennaFile object. ```APIDOC ## open ### Description Opens a path to a text file and returns a relevant file object. Arguments match Python's built-in open function. ### Parameters - **path** (str) - Required - Path to file to open. - **seq_type** (str) - Optional - Type of FoldRecord to return. - **error_mode** (str) - Optional - Error handling mode. ``` -------------------------------- ### View hyb_analyze usage help Source: https://github.com/rennelab/hybkit/blob/master/docs/source/toolkit/hyb_analyze.md Displays the full command-line interface usage and available arguments for the hyb_analyze utility. ```bash usage: hyb_analysis [-h] -i PATH_TO/MY_FILE.HYB [PATH_TO/MY_FILE.HYB ...] [-f [PATH_TO/MY_FILE.VIENNA [PATH_TO/MY_FILE.VIENNA ...]]] [-o PATH_TO/OUT_BASENAME [PATH_TO/OUT_BASENAME ...]] [-d OUT_DIR] [-u OUT_SUFFIX] [-a {energy,type,mirna,target,fold} [{energy,type,mirna,target,fold} ...]] [-n ANALYSIS_NAME] [-p {True,False}] [--version] [-v | -s] [--mirna_types MIRNA_TYPES [MIRNA_TYPES ...]] [--custom_flags CUSTOM_FLAGS [CUSTOM_FLAGS ...]] [--hyb_placeholder HYB_PLACEHOLDER] [--reorder_flags {True,False}] [--allow_undefined_flags [{True,False}]] [--allow_unknown_seg_types [{True,False}]] [--hybformat_id [{True,False}]] [--hybformat_ref [{True,False}]] [--allowed_mismatches ALLOWED_MISMATCHES] [--fold_placeholder FOLD_PLACEHOLDER] [-y {static,dynamic}] [--error_mode {raise,warn_return,return}] [--error_checks {hybrecord_indel,foldrecord_nofold,max_mismatch,energy_mismatch} [{hybrecord_indel,foldrecord_nofold,max_mismatch,energy_mismatch} ...]] [--iter_error_mode {raise,warn_return,warn_skip,skip,return}] [--max_sequential_skips MAX_SEQUENTIAL_SKIPS] [--quant_mode {single,reads,records}] [--out_delim OUT_DELIM] ``` -------------------------------- ### POST /hybrecord/from_line Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.md Constructs a HybRecord instance from a single-line hyb-format string. ```APIDOC ## POST /hybrecord/from_line ### Description Construct a HybRecord instance from a single-line hyb-format string. ### Method POST ### Parameters #### Request Body - **line** (str) - Required - hyb-format string containing record information. - **hybformat_id** (bool) - Optional - If True, read count information from identifier in _ format. - **hybformat_ref** (bool) - Optional - If True, read additional record information from identifier in ___ format. ### Response #### Success Response (200) - **HybRecord** (object) - Instance containing record information. ``` -------------------------------- ### Constructor: hybkit.HybRecord Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.md Initializes a new HybRecord object with sequence information and optional segment properties. ```APIDOC ## Constructor: hybkit.HybRecord ### Description Creates a new instance of a HybRecord to represent a chimeric hybrid sequence. ### Parameters #### Request Body - **id** (str) - Required - Identifier for the hyb record. - **seq** (str) - Required - Nucleotide sequence of the hyb record. - **energy** (str or float) - Optional - Predicted energy of sequence folding in kcal/mol. - **seg1_props** (dict) - Optional - Properties of segment 1 (ref_name, read_start, read_end, ref_start, ref_end, score). - **seg2_props** (dict) - Optional - Properties of segment 2 (ref_name, read_start, read_end, ref_start, ref_end, score). - **flags** (dict) - Optional - Dictionary of flags for the record. - **allow_undefined_flags** (bool) - Optional - If True, allows flags not defined in ALL_FLAGS. ### Request Example { "id": "2407_718", "seq": "ATCACATTGCCAGGGATTTCCAATCCCCAACAATGTGAAAACGGCTGTC", "seg1_props": { "ref_name": "MIMAT0000078", "read_start": 1, "read_end": 21, "score": 0.0027 } } ``` -------------------------------- ### Filter Records Where Segment Identifiers Contain a Substring Source: https://github.com/rennelab/hybkit/blob/master/docs/source/toolkit/hyb_filter.md Use the `--filter` option with `seg_contains` to select records where the segment identifier string contains a specific substring. This example filters for records where the segment identifier contains 'kshv'. ```bash hyb_filter -i my_file_1.hyb --filter seg_contains kshv ``` -------------------------------- ### View hyb_check usage help Source: https://github.com/rennelab/hybkit/blob/master/docs/source/toolkit/hyb_check.md Displays the full command-line argument structure for hyb_check. ```default usage: hyb_check [-h] -i PATH_TO/MY_FILE.HYB [PATH_TO/MY_FILE.HYB ...] [-f [PATH_TO/MY_FILE.VIENNA [PATH_TO/MY_FILE.VIENNA ...]]] [--version] [-v | -s] [--mirna_types MIRNA_TYPES [MIRNA_TYPES ...]] [--custom_flags CUSTOM_FLAGS [CUSTOM_FLAGS ...]] [--hyb_placeholder HYB_PLACEHOLDER] [--reorder_flags {True,False}] [--allow_undefined_flags [{True,False}]] [--allow_unknown_seg_types [{True,False}]] [--hybformat_id [{True,False}]] [--hybformat_ref [{True,False}]] [--allowed_mismatches ALLOWED_MISMATCHES] [--fold_placeholder FOLD_PLACEHOLDER] [-y {static,dynamic}] [--error_mode {raise,warn_return,return}] [--error_checks {hybrecord_indel,foldrecord_nofold,max_mismatch,energy_mismatch} [{hybrecord_indel,foldrecord_nofold,max_mismatch,energy_mismatch} ...]] [--iter_error_mode {raise,warn_return,warn_skip,skip,return}] [--max_sequential_skips MAX_SEQUENTIAL_SKIPS] ``` -------------------------------- ### Include Records with Specific Segment Types Source: https://github.com/rennelab/hybkit/blob/master/docs/source/toolkit/hyb_filter.md Use `--include` to specify criteria for inclusion. This example includes records where the hyb record's segtype is 'mRNA'. Ensure input files are correctly specified with `-i` and `-f`. ```bash hyb_filter -i my_file_1.hyb -f my_file_1.vienna \ --include seg_type mRNA ``` -------------------------------- ### Path and Argument Utilities Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit_api.md Functions for creating output file names and validating arguments. ```APIDOC ## make_out_file_name() ### Description Creates a standardized output file name. ### Method N/A (Python function) ### Endpoint N/A ### Parameters #### Path Parameters - **base_name** (str) - Required - The base name for the output file. - **suffix** (str) - Optional - A suffix to append to the file name. - **extension** (str) - Optional - The file extension. ### Request Example ```python from hybkit.util import make_out_file_name output_file = make_out_file_name('my_analysis', suffix='_results', extension='txt') print(output_file) # Example: my_analysis_results.txt ``` ### Response #### Success Response (str) - **filename** (str) - The generated output file name. ### Response Example ```json "my_analysis_results.txt" ``` ## validate_args() ### Description Validates function arguments. ### Method N/A (Python function) ### Endpoint N/A ### Parameters #### Path Parameters - **args** (dict) - Required - A dictionary of arguments to validate. - **expected_args** (dict) - Required - A dictionary defining the expected arguments and their types/constraints. ### Request Example ```python from hybkit.util import validate_args my_args = {'input': 'data.fasta', 'output': 'results.txt'} expected = {'input': str, 'output': str} validate_args(my_args, expected) ``` ### Response #### Success Response (None) - This function returns None on success. ## validate_args_exit() ### Description Validates function arguments and exits if validation fails. ### Method N/A (Python function) ### Endpoint N/A ### Parameters #### Path Parameters - **args** (dict) - Required - A dictionary of arguments to validate. - **expected_args** (dict) - Required - A dictionary defining the expected arguments and their types/constraints. ### Request Example ```python from hybkit.util import validate_args_exit my_args = {'input': 'data.fasta'} expected = {'input': str, 'output': str} validate_args_exit(my_args, expected) # Will exit if 'output' is missing ``` ### Response #### Success Response (None) - This function returns None on success and exits the program on failure. ## set_setting() ### Description Sets a specific configuration setting. ### Method N/A (Python function) ### Endpoint N/A ### Parameters #### Path Parameters - **key** (str) - Required - The key of the setting to set. - **value** (any) - Required - The value to assign to the setting. ### Request Example ```python from hybkit.util import set_setting set_setting('log_level', 'INFO') ``` ### Response #### Success Response (None) - This function returns None. ## set_settings_from_namespace() ### Description Sets multiple configuration settings from a namespace object. ### Method N/A (Python function) ### Endpoint N/A ### Parameters #### Path Parameters - **namespace** (object) - Required - An object containing settings as attributes. ### Request Example ```python from hybkit.util import set_settings_from_namespace class Config: def __init__(self): self.threads = 4 self.verbose = True config = Config() set_settings_from_namespace(config) ``` ### Response #### Success Response (None) - This function returns None. ``` -------------------------------- ### Include Records with a Specific First Segment Type Source: https://github.com/rennelab/hybkit/blob/master/docs/source/toolkit/hyb_filter.md Use `--include` with a specific segment index like `seg1_type` to filter based on the type of the first segment (5' end). This example includes records where the first segment type is 'mRNA'. ```bash hyb_filter -i my_file_1.hyb --include seg1_type mRNA ``` -------------------------------- ### Match ALL Filtering Criteria Source: https://github.com/rennelab/hybkit/blob/master/docs/source/toolkit/hyb_filter.md When using multiple `--filter` or `--filter_2` options, the default behavior is 'any' match. To require all criteria to be met, use `--filter_mode all`. This example outputs records where the segment identifier contains 'kshv' AND the segtype is 'miRNA'. ```bash hyb_filter -i my_file_1.hyb -f my_file_1.vienna \ --filter seg_contains kshv \ --filter_2 seg_type miRNA ``` -------------------------------- ### Download Hybkit Package Source: https://github.com/rennelab/hybkit/blob/master/docs/index.md Alternatively, download the zipped package using curl and unzip it. ```bash $ curl -OL https://github.com/RenneLab/hybkit/archive/master.zip $ unzip master.zip ``` -------------------------------- ### Iterate and Print Hyb IDs from File Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.md Shows how to open a hyb-format file using HybFile and iterate through each record to print its unique identifier. This utilizes the HybRecord.from_line() constructor internally. ```python with hybkit.HybFile('path/to/file.hyb', 'r') as hyb_file: # performs "hyb_record = hybkit.HybRecord.from_line(line)" for each line in file for hyb_record in hyb_file: print(hyb_record.id) ``` -------------------------------- ### Include Records with Segment Types Containing a Substring Source: https://github.com/rennelab/hybkit/blob/master/docs/source/toolkit/hyb_filter.md Use `--include` with `seg_type_contains` to filter records where the segment type string contains a specified substring. This example includes records with segment types containing 'RNA'. Multiple input files can be processed. ```bash hyb_filter -i my_file_1.hyb my_file_2.hyb -f my_file_1.vienna my_file_2.vienna \ --include seg_type_contains RNA ``` -------------------------------- ### set_settings_from_namespace Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.util.md Updates multiple settings at once using an argparse namespace object. ```APIDOC ## set_settings_from_namespace ### Description Takes a namespace object as from an argparse parser and updates settings accordingly. ### Parameters #### Arguments - **nspace** (argparse.Namespace) - Required - Namespace containing settings. - **verbose** (bool) - Optional - If True, print when changing setting. ``` -------------------------------- ### Class: hybkit.CtFile Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.md Initializes a CtFile wrapper to iterate over .ct file records. ```APIDOC ## Class hybkit.CtFile ### Description Ct file wrapper that returns ".ct" file lines as FoldRecord objects. Note: This class is in beta stage. ### Parameters - **seq_type** (str) - Optional - Type of FoldRecord to return: 'static' or 'dynamic'. - **error_mode** (str) - Optional - Error handling mode: 'raise', 'warn_return', or 'return'. - **from_file_like** (bool) - Optional - If True, treats the first argument as a file-like object. - **args** (Any) - Optional - Passed to open(). - **kwargs** (Any) - Optional - Passed to open(). ``` -------------------------------- ### Initialize Analysis Class Source: https://context7.com/rennelab/hybkit/llms.txt Initialize the Analysis class with desired analysis types and a name. Records can be added individually or in batches. ```python import hybkit # Initialize analysis with desired types analysis = hybkit.analysis.Analysis( analysis_types=['type', 'mirna', 'target'], name='My_Experiment' ) # Add records to analysis with hybkit.HybFile('data.hyb', 'r') as hyb_file: for hyb_record in hyb_file: hyb_record.eval_types() hyb_record.eval_mirna() analysis.add_hyb_record(hyb_record) # Or add all records at once with auto-evaluation with hybkit.HybFile('data.hyb', 'r') as hyb_file: records = hyb_file.read_records() analysis.add_hyb_records(records, eval_types=True, eval_mirna=True) # Get all results results = analysis.get_all_results() print(f"Type analysis count: {results['type']['types_analysis_count']}") print(f"Hybrid types: {results['type']['hybrid_types'].most_common(5)}") print(f"miRNAs with 5p position: {results['mirna']['mirnas_5p']}") print(f"Top targets: {results['target']['target_names'].most_common(10)}") # Get specific result mirna_count = analysis.get_specific_result('has_mirna') print(f"Records with miRNA: {mirna_count}") # Write results to CSV files analysis.write_analysis_results_special(out_basename='results/experiment') # Creates: results/experiment_type_hybrid_types.csv, # results/experiment_mirna_results.csv, # results/experiment_target_names.csv, etc. # Generate plots analysis.plot_analysis_results(out_basename='results/experiment') # Creates: results/experiment_types_hybrid_types.png, # results/experiment_target_names.png, etc. ``` -------------------------------- ### Iterate Over Paired Hyb and Fold Files Source: https://context7.com/rennelab/hybkit/llms.txt Synchronize iteration over paired hyb and fold files. Optionally combine them into unified HybRecord objects with attached fold information. ```python import hybkit # Iterate over paired hyb and fold files with hybkit.HybFile('data.hyb', 'r') as hyb_file, \ hybkit.ViennaFile('data.vienna', 'r') as vienna_file: # Option 1: Get separate records fold_iter = hybkit.HybFoldIter(hyb_file, vienna_file, combine=False) for hyb_record, fold_record in fold_iter: print(f"Hyb: {hyb_record.id}, Fold energy: {fold_record.energy}") # Option 2: Combine fold into hyb record (recommended) with hybkit.HybFile('data.hyb', 'r') as hyb_file, \ hybkit.ViennaFile('data.vienna', 'r') as vienna_file: fold_iter = hybkit.HybFoldIter(hyb_file, vienna_file, combine=True) for hyb_record in fold_iter: # fold_record is now attached to hyb_record print(f"ID: {hyb_record.id}") print(f"Fold: {hyb_record.fold_record.fold}") print(f"Energy: {hyb_record.fold_record.energy}") # Get miRNA fold pattern if miRNA present hyb_record.eval_types() hyb_record.eval_mirna() if hyb_record.prop('has_mirna') and hyb_record.prop('mirna_not_dimer'): mirna_fold = hyb_record.mirna_details('mirna_fold') print(f"miRNA fold: {mirna_fold}") # Print iteration report fold_iter.print_report() ``` -------------------------------- ### HybFoldIter Class Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.md Documentation for the HybFoldIter class, for concurrent iteration over HybFile and ViennaFile/CtFile. ```APIDOC ## hybkit.HybFoldIter ### Description Class for concurrent iteration over a [`HybFile`](#hybkit.HybFile) and a [`ViennaFile`](#hybkit.ViennaFile) or [`CtFile`](#hybkit.CtFile). ### Class Signature ```python class hybkit.HybFoldIter(hyb_file: HybFile, fold_file: ViennaFile | CtFile) ``` ### Parameters #### Path Parameters - **hyb_file** (HybFile) - Required - An opened `HybFile` object. - **fold_file** (ViennaFile | CtFile) - Required - An opened `ViennaFile` or `CtFile` object. ### Example Usage ```python # Assuming hyb_file_path and vienna_file_path are valid file paths # with hybkit.HybFile(hyb_file_path, 'r') as hyb_f, \ # hybkit.ViennaFile(vienna_file_path, 'r') as vienna_f: # hyb_fold_iter = hybkit.HybFoldIter(hyb_f, vienna_f) # for hyb_record, fold_record in hyb_fold_iter: # print(f"Hyb ID: {hyb_record.id}, Structure: {fold_record.structure}") ``` ``` -------------------------------- ### Initialize Fold Analysis Source: https://context7.com/rennelab/hybkit/llms.txt Initialize fold analysis for RNA secondary structure binding patterns. Requires fold_record and eval_mirna to be set. ```python import hybkit # Initialize fold analysis (requires fold_record and eval_mirna) analysis = hybkit.analysis.Analysis( analysis_types=['fold'], name='Fold_Analysis' ) with hybkit.HybFile('data.hyb', 'r') as hyb_file, \ hybkit.ViennaFile('data.vienna', 'r') as vienna_file: fold_iter = hybkit.HybFoldIter(hyb_file, vienna_file, combine=True) for hyb_record in fold_iter: hyb_record.eval_types() hyb_record.eval_mirna() # Only add miRNA-containing records with fold info if hyb_record.prop('has_mirna'): analysis.add_hyb_record(hyb_record) # Get fold results fold_results = analysis.get_analysis_results('fold') print(f"Folds analyzed: {fold_results['fold_analysis_count']}") print(f"Match count distribution: {fold_results['fold_match_counts']}") print(f"Per-nucleotide binding counts: {fold_results['mirna_nt_fold_counts']}") print(f"Per-nucleotide binding proportions: {fold_results['mirna_nt_fold_props']}") # Write and plot analysis.write_analysis_results_special(out_basename='fold_results') analysis.plot_analysis_results(out_basename='fold_results') # Creates fold histograms showing binding patterns by miRNA position ``` -------------------------------- ### Provide specific output file names Source: https://github.com/rennelab/hybkit/blob/master/docs/source/toolkit/hyb_check.md Overrides automatic naming by providing explicit output file paths. ```default hyb_script [...] --out_hyb MY_OUT_DIR/OUT_FILE_1.HYB MY_OUT_DIR/OUT_FILE_2.HYB --> MY_OUT_DIR/OUT_FILE_1.hyb --> MY_OUT_DIR/OUT_FILE_2.hyb ``` -------------------------------- ### View hyb_eval usage help Source: https://github.com/rennelab/hybkit/blob/master/docs/source/toolkit/hyb_eval.md Displays the full command-line interface usage and available arguments for hyb_eval. ```bash usage: hyb_analysis [-h] -i PATH_TO/MY_FILE.HYB [PATH_TO/MY_FILE.HYB ...] [-f [PATH_TO/MY_FILE.VIENNA [PATH_TO/MY_FILE.VIENNA ...]]] [-o PATH_TO/OUT_FILE.HYB [PATH_TO/OUT_FILE.HYB ...]] [-l PATH_TO/OUT_FILE.VIENNA [PATH_TO/OUT_FILE.VIENNA ...]] [-d OUT_DIR] [-u OUT_SUFFIX] [-t {type,mirna} [{type,mirna} ...]] [--type_method {hybformat,string_match,id_map}] [--type_params_file PATH_TO/PARAMETERS_FILE] [--set_dataset] [--version] [-v | -s] [--mirna_types MIRNA_TYPES [MIRNA_TYPES ...]] [--custom_flags CUSTOM_FLAGS [CUSTOM_FLAGS ...]] [--hyb_placeholder HYB_PLACEHOLDER] [--reorder_flags {True,False}] [--allow_undefined_flags [{True,False}]] [--allow_unknown_seg_types [{True,False}]] [--hybformat_id [{True,False}]] [--hybformat_ref [{True,False}]] [--allowed_mismatches ALLOWED_MISMATCHES] [--fold_placeholder FOLD_PLACEHOLDER] [-y {static,dynamic}] [--error_mode {raise,warn_return,return}] [--error_checks {hybrecord_indel,foldrecord_nofold,max_mismatch,energy_mismatch} [{hybrecord_indel,foldrecord_nofold,max_mismatch,energy_mismatch} ...]] [--iter_error_mode {raise,warn_return,warn_skip,skip,return}] [--max_sequential_skips MAX_SEQUENTIAL_SKIPS] ``` -------------------------------- ### HybFile Class Method: open Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.md A class method to open a path to a text file using the built-in `open()` function and return a HybFile object. ```APIDOC ## *classmethod* hybkit.HybFile.open(path: str, *args: Any, hybformat_id: bool | None = None, hybformat_ref: bool | None = None, **kwargs: Any) -> Self ### Description Open a path to a text file using `open()` and return a HybFile object. Arguments match those of the Python3 built-in `open()` function and are passed directly to it. This method is provided as a convenience function for drop-in replacement of the built-in `open()` function. ### Parameters #### Path Parameter - **path** (str) - Required - Path to file to open. #### HybFile-Specific Keyword Arguments - **hybformat_id** (bool, optional) - If `True`, during parsing of lines read count information from identifier in `_` format. Defaults to value in `settings['hybformat_id']`. - **hybformat_ref** (bool, optional) - If `True`, during parsing of lines read additional record information from identifier in `___` format. Defaults to value in `settings['hybformat_ref']`. #### Other Parameters - **\*args** - Passed directly to `open()`. - **\*\*kwargs** - Passed directly to `open()`. ### Returns - **HybFile** object. ### Example Usage ```python with HybFile.open('path/to/file.hyb', 'r') as hyb_file: for record in hyb_file: print(record) ``` ``` -------------------------------- ### Open and Read HybFile Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.md Opens a hyb-format file for reading and iterates through its records. Use this for processing existing hyb files. ```python with HybFile.open('path/to/file.hyb', 'r') as hyb_file: for record in hyb_file: print(record) ``` -------------------------------- ### Clone Hybkit Repository Source: https://github.com/rennelab/hybkit/blob/master/docs/index.md Use git to clone the project's Github repository. ```bash $ git clone git://github.com/RenneLab/hybkit ``` -------------------------------- ### Download Hyb Data Source: https://github.com/rennelab/hybkit/blob/master/docs/example_01_link.md Use this command to download and uncompress the necessary Hyb data files for the analysis. The unpacked data requires approximately 2 GB of disk space. ```default $ sh ./download_data.sh ``` -------------------------------- ### Customize output directory Source: https://github.com/rennelab/hybkit/blob/master/docs/source/toolkit/hyb_check.md Specifies a custom output directory for generated files. ```default hyb_script -i PATH_TO/MY_FILE_1.HYB [...] --out_dir MY_OUT_DIR --> MY_OUT_DIR/MY_FILE_1_ADDSUFFIX.HYB ``` -------------------------------- ### Configure string match parameters Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.type_finder.md Defines search patterns for identifying segment types based on string matching criteria. ```default params = {'endswith': [('_miR', 'microRNA'), ('_trans', 'mRNA') ]} ``` ```default #comment line #search_type,search_string,seg_type endswith,_miR,microRNA endswith,_trans,mRNA ``` -------------------------------- ### Run Command-Line Script Tests Source: https://github.com/rennelab/hybkit/blob/master/docs/index.md Execute the auto_test.sh script located in the auto_tests directory to test command-line scripts. ```bash $ ./auto_tests/auto_test.sh ``` -------------------------------- ### Generate string match parameters from CSV Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.type_finder.md Creates a parameter dictionary for method_string_match from a CSV legend file. ```default {'endswith': [('_miR', 'microRNA'), ('_trans', 'mRNA') ]} ``` -------------------------------- ### Hybkit Settings Definitions Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.settings.md Configuration settings for core Hybkit classes. ```APIDOC ## Hybkit Settings ### HybFile_settings - **hybformat_id** (bool) - Default: False - **hybformat_ref** (bool) - Default: False ### FoldRecord_settings - **allowed_mismatches** (int) - Default: 0 - **error_mode** (str) - Default: 'raise' - **fold_placeholder** (str) - Default: '.' - **seq_type** (str) - Default: 'static' ### FoldFile_settings - (Empty dictionary) ### HybFoldIter_settings - **error_checks** (list) - Default: ['hybrecord_indel', 'foldrecord_nofold', 'max_mismatch', 'energy_mismatch'] - **iter_error_mode** (str) - Default: 'warn_skip' - **max_sequential_skips** (int) - Default: 100 ### Analysis_settings - **out_delim** (str) - Default: ',' - **quant_mode** (str) - Default: 'single' ```