### Install Hybkit using SetupTools

Source: https://github.com/rennelab/hybkit/blob/master/docs/index.md

After cloning or downloading, install the package using python setuptools.

```bash
$ python setup.py install
```

--------------------------------

### Install Pytest and Run Tests

Source: https://github.com/rennelab/hybkit/blob/master/docs/index.md

Install pytest and run the unit test suite from the root directory of the hybkit package.

```bash
$ pip install pytest
$ pytest
```

--------------------------------

### Example .hyb format line

Source: https://github.com/rennelab/hybkit/blob/master/docs/source/specification.md

A sample line demonstrating the tab-delimited structure of a .hyb file.

```default
2407_718    ATCACATTGCCAGGGATTTCCAATCCCCAACAATGTGAAAACGGCTGTC       .       MIMAT0000078_MirBase_miR-23a_microRNA   1       21      1       21      0.0027  ENSG00000188229_ENST00000340384_TUBB2C_mRNA     23      49      1181    1207    1.2e-06
```

--------------------------------

### Install Hybkit via Python PIP

Source: https://github.com/rennelab/hybkit/blob/master/docs/index.md

Install the hybkit package and its dependencies using pip, the Python package installer. This is the recommended installation method.

```bash
$ python3 -m pip install hybkit
```

--------------------------------

### Run hyb_check system calls

Source: https://github.com/rennelab/hybkit/blob/master/docs/source/toolkit/hyb_check.md

Examples of executing hyb_check with single or multiple input files and optional fold files.

```default
hyb_check -i my_file_1.hyb -f my_file_1.vienna
hyb_check -i my_file_1.hyb my_file_2.hyb -f my_file_1.vienna \
    my_file_2.vienna -v --custom_flags myflag
```

--------------------------------

### CT File Format Example

Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.md

Example of the .ct file format used by UNAFold and other packages. It includes sequence information, base pairing details, and energy values.

```default
41        dG = -8 dH = -93.9      seq1_name-seq2_name
1 A       0       2       0       1       0       0
2 G       1       3       0       2       0       0
...
...
...
40        G       39      41      11      17      39      41
41        T       40      0       10      18      40      0
```

--------------------------------

### Execute hyb_analyze system calls

Source: https://github.com/rennelab/hybkit/blob/master/docs/source/toolkit/hyb_analyze.md

Examples of running the hyb_analyze utility from the command line with different input formats and plot configurations.

```bash
$ hyb_analyze -a fold -i my_file_1.hyb -f my_file_1.vienna
  <br/>
  $ hyb_analyze -a fold -i my_file_2.hyb -f my_file_2.ct \
              --make_plots False
```

--------------------------------

### Combine type and miRNA evaluation

Source: https://github.com/rennelab/hybkit/blob/master/docs/source/toolkit/hyb_eval.md

Example of running both type and miRNA evaluations in a single command.

```bash
$ hyb_eval -t type mirna -i my_file_1.hyb \
            --type_method string_match \
            --type_parameters my_parameters_file.csv \
            --allow_unknown_seg_types \
            --mirna_types miRNA kshv-miRNA
```

--------------------------------

### Hyb Record Example Line

Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.md

An example string representing a single line in the hyb-format file, containing detailed information about a chimeric RNA sequence read.

```text
2407_718	ATCACATTGCCAGGGATTTCCAATCCCCAACAATGTGAAAACGGCTGTC	.	MIMAT0000078_MirBase_miR-23a_microRNA	1	21	1	21	0.0027	ENSG00000188229_ENST00000340384_TUBB2C_mRNA	23	49	1181	1207	1.2e-06
```

--------------------------------

### Vienna File Format Example

Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.md

Example of the .vienna file format used by the ViennaRNA package. It includes a sequence identifier, the nucleotide sequence, and its dot-bracket fold representation with an associated energy value.

```default
34_151138_MIMAT0000076_MirBase_miR-21_microRNA_1_19-...
TAGCTTATCAGACTGATGTTAGCTTATCAGACTGATG
.....((((((.((((((......)))))).))))))   (-11.1)
```

--------------------------------

### Static vs. Dynamic FoldRecord Alignment Example

Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.md

Illustrates the difference between static and dynamic FoldRecord sequences based on overlapping and gapped alignments. Static sequences match HybRecord.seq exactly, while dynamic sequences are reconstructed from aligned regions.

```default
Static:
seg1: 1111111111111111111111
seg2:                   222222222222222222222
seq:  TAGCTTATCAGACTGATGTTTTAGCTTATCAGACTGATG

Dynamic:
seg1: 1111111111111111111111
seg2:                       222222222222222222222
seq:  TAGCTTATCAGACTGATGTTTTTTTTAGCTTATCAGACTGATG
```

```default
Static:
seg1:   1111111111111111
seg2:                     222222222222222222
seq:  TTAGCTTATCAGACTGATGTTAGCTTATCAGACTGATG

Dynamic:
seg1: 1111111111111111
seg2:                 222222222222222222
seq:  AGCTTATCAGACTGATTAGCTTATCAGACTGATG
```

--------------------------------

### Match ANY Filtering Criteria (Default Behavior)

Source: https://github.com/rennelab/hybkit/blob/master/docs/source/toolkit/hyb_filter.md

The default filter mode is 'any', meaning records are included if they match at least one of the specified criteria. This example outputs records with a segtype of either 'miRNA' or 'lncRNA'.

```bash
hyb_filter -i my_file_1.hyb --filter_mode any \
              --filter seg_type miRNA \
              --filter_2 seg_type lncRNA
```

--------------------------------

### Install Hybkit via Conda

Source: https://github.com/rennelab/hybkit/blob/master/docs/index.md

Install the hybkit package and dependencies from the Bioconda channel using the conda package manager.

```bash
$ conda install -c bioconda hybkit
```

--------------------------------

### Configure Automatic Output Naming

Source: https://github.com/rennelab/hybkit/blob/master/docs/source/toolkit/hyb_analyze.md

Demonstrates default output naming behavior and how to customize the output directory and suffix.

```default
hyb_script -i PATH_TO/MY_FILE_1.HYB [...]
    -->  OUT_DIR/MY_FILE_1_ADDSUFFIX.HYB
```

```default
hyb_script -i PATH_TO/MY_FILE_1.HYB [...] --out_dir MY_OUT_DIR
    -->  MY_OUT_DIR/MY_FILE_1_ADDSUFFIX.HYB
```

```default
hyb_script -i PATH_TO/MY_FILE_1.HYB [...] --out_suffix MY_SUFFIX
    -->  OUT_DIR/MY_FILE_1_MY_SUFFIX.HYB
#OR
hyb_script -i PATH_TO/MY_FILE_1.HYB [...] --out_suffix MY_SUFFIX.HYB
    -->  OUT_DIR/MY_FILE_1_MY_SUFFIX.HYB
```

--------------------------------

### Create and Parse HybRecord

Source: https://context7.com/rennelab/hybkit/llms.txt

Demonstrates creating a HybRecord from scratch and parsing one from a hyb-format line. Accesses record properties and converts back to a line.

```python
import hybkit

# Create a HybRecord from scratch
seg1_props = {
    'ref_name': 'MIMAT0000078_MirBase_miR-23a_microRNA',
    'read_start': 1,
    'read_end': 21,
    'ref_start': 1,
    'ref_end': 21,
    'score': 0.0027
}
seg2_props = {
    'ref_name': 'ENSG00000188229_ENST00000340384_TUBB2C_mRNA',
    'read_start': 23,
    'read_end': 49,
    'ref_start': 1181,
    'ref_end': 1207,
    'score': 1.2e-06
}

hyb_record = hybkit.HybRecord(
    id='2407_718',
    seq='ATCACATTGCCAGGGATTTCCAATCCCCAACAATGTGAAAACGGCTGTC',
    energy='-7.3',
    seg1_props=seg1_props,
    seg2_props=seg2_props
)

# Parse from a hyb-format line (typical usage)
line = "2407_718\tATCACATTGCCAGGGATTTCCAATCCCCAACAATGTGAAAACGGCTGTC\t.\tMIMAT0000078_MirBase_miR-23a_microRNA\t1\t21\t1\t21\t0.0027\tENSG00000188229_ENST00000340384_TUBB2C_mRNA\t23\t49\t1181\t1207\t1.2e-06"
hyb_record = hybkit.HybRecord.from_line(line)

# Access record properties
print(f"ID: {hyb_record.id}")
print(f"Sequence: {hyb_record.seq}")
print(f"Length: {len(hyb_record)}")
print(f"Seg1 Reference: {hyb_record.seg1_props['ref_name']}")
print(f"Seg2 Reference: {hyb_record.seg2_props['ref_name']}")

# Convert back to hyb format line
output_line = hyb_record.to_line()
```

--------------------------------

### Automate analysis with Python

Source: https://context7.com/rennelab/hybkit/llms.txt

A complete Python workflow for configuring settings, defining type matching, and initializing analysis.

```python
#!/usr/bin/env python3
import os
import hybkit

# Configuration
input_files = ['sample1.hyb', 'sample2.hyb', 'sample3.hyb']
output_dir = 'analysis_output'
os.makedirs(output_dir, exist_ok=True)

# Configure miRNA types (include custom viral miRNAs)
hybkit.settings.HybRecord_settings['mirna_types'] = ['microRNA', 'miRNA', 'KSHV-miRNA']

# Set up type finding with string matching
legend_file = 'string_match_legend.csv'
match_params = hybkit.HybRecord.TypeFinder.make_string_match_params(legend_file)
hybkit.HybRecord.TypeFinder.set_method('string_match', match_params)

# Types to exclude (QC filtering)
exclude_types = ['rRNA', 'mitoch-rRNA']

# Initialize combined analysis
combined_analysis = hybkit.analysis.Analysis(
    analysis_types=['type', 'mirna', 'target'],
    name='Combined_Analysis'
)
```

--------------------------------

### Create HybRecord with Basic Information

Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.md

Initialize a HybRecord object with an ID, sequence, and optional energy value. This is a basic way to create a record.

```python
hyb_record_1 = hybkit.HybRecord('1_100', 'ACTG')
hyb_record_2 = hybkit.HybRecord('2_107', 'CTAG', '-7.3')
hyb_record_3 = hybkit.HybRecord('3_295', 'CTTG', energy='-10.3')
```

--------------------------------

### Construct HybRecord from Line

Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.md

Demonstrates the preferred method for creating a HybRecord object by parsing a single line from a hyb-format file using the from_line() constructor.

```python
# line = "2407_718\tATC..."
hyb_record = hybkit.HybRecord.from_line(line)
```

--------------------------------

### GET /hybrecord/to_fields_header

Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.md

Returns a list of the fields in a HybRecord object.

```APIDOC
## GET /hybrecord/to_fields_header

### Description
Return a list of the fields in a HybRecord object for use with the to_fields() method.

### Method
GET

### Response
#### Success Response (200)
- **fields** (list) - List of field names: id, seq, energy, seg1_ref_name, seg1_read_start, seg1_read_end, seg1_ref_start, seg1_ref_end, seg1_score, seg2_ref_name, seg2_read_start, seg2_read_end, seg2_ref_start, seg2_ref_end, seg2_score, flags.
```

--------------------------------

### GET /hybrecord/to_csv_header

Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.md

Returns a comma-separated string representation of the fields in the record.

```APIDOC
## GET /hybrecord/to_csv_header

### Description
Return a comma-separated string representation of the fields in the record for use with the to_csv() method.

### Method
GET

### Parameters
#### Query Parameters
- **newline** (bool) - Optional - If True, end the returned string with a newline.

### Response
#### Success Response (200)
- **header** (string) - Comma-separated string of field names.
```

--------------------------------

### ViennaFile Constructor

Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.md

Initializes a new ViennaFile instance to wrap a Vienna-format file.

```APIDOC
## ViennaFile Constructor

### Description
Initializes the ViennaFile wrapper to process Vienna-format file lines as FoldRecord objects.

### Parameters
- **seq_type** (str) - Optional - Type of FoldRecord to return: 'static' or 'dynamic'.
- **error_mode** (str) - Optional - Error handling mode: 'raise', 'warn_return', or 'return'.
- **from_file_like** (bool) - Optional - If True, treats the first argument as a file-like object.
```

--------------------------------

### Method: open()

Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.md

Class method to open a path to a text file and return a file object.

```APIDOC
## Method open()

### Description
Open a path to a text file and return a relevant file object.

### Parameters
- **path** (str) - Required - Path to file to open.
- **seq_type** (str) - Optional - Type of FoldRecord to return.
- **error_mode** (str) - Optional - Error handling mode.

### Response
- **Return Type** (HybFile) - The opened file object.
```

--------------------------------

### Configure FoldFile Settings

Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.settings.md

Placeholder for FoldFile settings information. Currently an empty dictionary, indicating default or no specific configurations are defined here.

```python
hybkit.settings.FoldFile_settings_info = {

}
```

--------------------------------

### Find Segment Type

Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.type_finder.md

Example of the internal call structure used by the find method to determine segment types.

```default
seg_type = :meth:`TypeFinder.find_custom_method`(seg_props, :attr`TypeFinder.params`)
```

--------------------------------

### Perform miRNA evaluation with hyb_eval

Source: https://github.com/rennelab/hybkit/blob/master/docs/source/toolkit/hyb_eval.md

Examples of using the miRNA evaluation mode to identify miRNA properties within hybrids.

```bash
$ hyb_eval -t mirna -i my_file_1.hyb
```

```bash
$ hyb_eval -t mirna -i my_file_1.hyb -f my_file_1.vienna
```

```bash
$ hyb_eval -t mirna -i my_file_1.hyb my_vile_2.hyb \
            -f my_file_1.vienna my_file_2.vienna \
            --mirna_types miRNA kshv-miRNA
```

--------------------------------

### HybFile Class Constructor

Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.md

Initializes a HybFile object, which wraps a hyb-format text file and returns entries as HybRecord objects.

```APIDOC
## hybkit.HybFile(path: str, *args: Any, hybformat_id: bool | None = None, hybformat_ref: bool | None = None, from_file_like: bool = False, **kwargs: Any)

### Description
Wrapper for a hyb-format text file which returns entries (lines) as HybRecord objects.

### Parameters
#### Path Parameter
- **path** (str) - Required - Path to text file to open as hyb-format file.

#### Other Parameters
- **\*args** - Arguments passed to `open()` function to open a text file for reading/writing.
- **hybformat_id** (bool, optional) - If `True`, during parsing of lines read count information from identifier in `<read_number>_<read_count>` format. Defaults to value in `settings['hybformat_id']`.
- **hybformat_ref** (bool, optional) - If `True`, during parsing of lines read additional record information from identifier in `<gene_id>_<transcript_id>_<gene_name>_<seg_type>` format. Defaults to value in `settings['hybformat_ref']`.
- **from_file_like** (bool, optional) - If `True`, the first argument is treated as a file-like object (such as io.StringIO or gzip.GzipFile) and the remaining positional arguments are ignored. (Default False)
- **\*\*kwargs** - Keyword arguments passed to `open()` function to open a text file for reading/writing.

### Variables
- **hybformat_id** (bool) - Read count information from identifier during line parsing
- **hybformat_ref** (bool) - Read type information from reference name during line parsing
- **fh** (file) - Underlying file handle for the HybFile object.

#### settings *= {'hybformat_id': False, 'hybformat_ref': False}*
Class-level settings. See `hybkit.settings.HybFile_settings_info` for descriptions.

```

--------------------------------

### Perform type evaluation with hyb_eval

Source: https://github.com/rennelab/hybkit/blob/master/docs/source/toolkit/hyb_eval.md

Examples of using the type evaluation mode to assign segment types to hybrid records.

```bash
$ hyb_eval -t type -i my_file_1.hyb
```

```bash
$ hyb_eval -t type -i my_file_1.hyb -f my_file_1.vienna
```

```bash
$ hyb_eval -t type \
            -i my_file_1.hyb my_file_2.hyb \
            -f my_file_1.vienna my_file_2.vienna \
            --type_method string_match \
            --type_parameters my_parameters_file.csv \
            --allow_unknown_seg_types
```

--------------------------------

### Direct HybRecord Construction

Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.md

Illustrates how to directly construct a HybRecord object by providing the minimum required data: the sequence and its identifier. Other parameters are optional.

```python
# Example of direct construction (not shown in source, but implied by class signature)
# hyb_record = hybkit.HybRecord(id='example_id', seq='ATCGATCG')
pass
```

--------------------------------

### open

Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.md

Class method to open a path to a text file and return a ViennaFile object.

```APIDOC
## open

### Description
Opens a path to a text file and returns a relevant file object. Arguments match Python's built-in open function.

### Parameters
- **path** (str) - Required - Path to file to open.
- **seq_type** (str) - Optional - Type of FoldRecord to return.
- **error_mode** (str) - Optional - Error handling mode.
```

--------------------------------

### View hyb_analyze usage help

Source: https://github.com/rennelab/hybkit/blob/master/docs/source/toolkit/hyb_analyze.md

Displays the full command-line interface usage and available arguments for the hyb_analyze utility.

```bash
usage: hyb_analysis [-h] -i PATH_TO/MY_FILE.HYB [PATH_TO/MY_FILE.HYB ...]
                    [-f [PATH_TO/MY_FILE.VIENNA [PATH_TO/MY_FILE.VIENNA ...]]]
                    [-o PATH_TO/OUT_BASENAME [PATH_TO/OUT_BASENAME ...]]
                    [-d OUT_DIR] [-u OUT_SUFFIX]
                    [-a {energy,type,mirna,target,fold} [{energy,type,mirna,target,fold} ...]]
                    [-n ANALYSIS_NAME] [-p {True,False}] [--version] [-v | -s]
                    [--mirna_types MIRNA_TYPES [MIRNA_TYPES ...]]
                    [--custom_flags CUSTOM_FLAGS [CUSTOM_FLAGS ...]]
                    [--hyb_placeholder HYB_PLACEHOLDER]
                    [--reorder_flags {True,False}]
                    [--allow_undefined_flags [{True,False}]]
                    [--allow_unknown_seg_types [{True,False}]]
                    [--hybformat_id [{True,False}]]
                    [--hybformat_ref [{True,False}]]
                    [--allowed_mismatches ALLOWED_MISMATCHES]
                    [--fold_placeholder FOLD_PLACEHOLDER]
                    [-y {static,dynamic}]
                    [--error_mode {raise,warn_return,return}]
                    [--error_checks {hybrecord_indel,foldrecord_nofold,max_mismatch,energy_mismatch} [{hybrecord_indel,foldrecord_nofold,max_mismatch,energy_mismatch} ...]]
                    [--iter_error_mode {raise,warn_return,warn_skip,skip,return}]
                    [--max_sequential_skips MAX_SEQUENTIAL_SKIPS]
                    [--quant_mode {single,reads,records}]
                    [--out_delim OUT_DELIM]
```

--------------------------------

### POST /hybrecord/from_line

Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.md

Constructs a HybRecord instance from a single-line hyb-format string.

```APIDOC
## POST /hybrecord/from_line

### Description
Construct a HybRecord instance from a single-line hyb-format string.

### Method
POST

### Parameters
#### Request Body
- **line** (str) - Required - hyb-format string containing record information.
- **hybformat_id** (bool) - Optional - If True, read count information from identifier in <read_number>_<read_count> format.
- **hybformat_ref** (bool) - Optional - If True, read additional record information from identifier in <gene_id>_<transcript_id>_<gene_name>_<seg_type> format.

### Response
#### Success Response (200)
- **HybRecord** (object) - Instance containing record information.
```

--------------------------------

### Constructor: hybkit.HybRecord

Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.md

Initializes a new HybRecord object with sequence information and optional segment properties.

```APIDOC
## Constructor: hybkit.HybRecord

### Description
Creates a new instance of a HybRecord to represent a chimeric hybrid sequence.

### Parameters
#### Request Body
- **id** (str) - Required - Identifier for the hyb record.
- **seq** (str) - Required - Nucleotide sequence of the hyb record.
- **energy** (str or float) - Optional - Predicted energy of sequence folding in kcal/mol.
- **seg1_props** (dict) - Optional - Properties of segment 1 (ref_name, read_start, read_end, ref_start, ref_end, score).
- **seg2_props** (dict) - Optional - Properties of segment 2 (ref_name, read_start, read_end, ref_start, ref_end, score).
- **flags** (dict) - Optional - Dictionary of flags for the record.
- **allow_undefined_flags** (bool) - Optional - If True, allows flags not defined in ALL_FLAGS.

### Request Example
{
  "id": "2407_718",
  "seq": "ATCACATTGCCAGGGATTTCCAATCCCCAACAATGTGAAAACGGCTGTC",
  "seg1_props": {
    "ref_name": "MIMAT0000078",
    "read_start": 1,
    "read_end": 21,
    "score": 0.0027
  }
}
```

--------------------------------

### Filter Records Where Segment Identifiers Contain a Substring

Source: https://github.com/rennelab/hybkit/blob/master/docs/source/toolkit/hyb_filter.md

Use the `--filter` option with `seg_contains` to select records where the segment identifier string contains a specific substring. This example filters for records where the segment identifier contains 'kshv'.

```bash
hyb_filter -i my_file_1.hyb --filter seg_contains kshv
```

--------------------------------

### View hyb_check usage help

Source: https://github.com/rennelab/hybkit/blob/master/docs/source/toolkit/hyb_check.md

Displays the full command-line argument structure for hyb_check.

```default
usage: hyb_check [-h] -i PATH_TO/MY_FILE.HYB [PATH_TO/MY_FILE.HYB ...]
                 [-f [PATH_TO/MY_FILE.VIENNA [PATH_TO/MY_FILE.VIENNA ...]]]
                 [--version] [-v | -s]
                 [--mirna_types MIRNA_TYPES [MIRNA_TYPES ...]]
                 [--custom_flags CUSTOM_FLAGS [CUSTOM_FLAGS ...]]
                 [--hyb_placeholder HYB_PLACEHOLDER]
                 [--reorder_flags {True,False}]
                 [--allow_undefined_flags [{True,False}]]
                 [--allow_unknown_seg_types [{True,False}]]
                 [--hybformat_id [{True,False}]]
                 [--hybformat_ref [{True,False}]]
                 [--allowed_mismatches ALLOWED_MISMATCHES]
                 [--fold_placeholder FOLD_PLACEHOLDER] [-y {static,dynamic}]
                 [--error_mode {raise,warn_return,return}]
                 [--error_checks {hybrecord_indel,foldrecord_nofold,max_mismatch,energy_mismatch} [{hybrecord_indel,foldrecord_nofold,max_mismatch,energy_mismatch} ...]]
                 [--iter_error_mode {raise,warn_return,warn_skip,skip,return}]
                 [--max_sequential_skips MAX_SEQUENTIAL_SKIPS]
```

--------------------------------

### Include Records with Specific Segment Types

Source: https://github.com/rennelab/hybkit/blob/master/docs/source/toolkit/hyb_filter.md

Use `--include` to specify criteria for inclusion. This example includes records where the hyb record's segtype is 'mRNA'. Ensure input files are correctly specified with `-i` and `-f`.

```bash
hyb_filter -i my_file_1.hyb -f my_file_1.vienna \
    --include seg_type mRNA
```

--------------------------------

### Path and Argument Utilities

Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit_api.md

Functions for creating output file names and validating arguments.

```APIDOC
## make_out_file_name()

### Description
Creates a standardized output file name.

### Method
N/A (Python function)

### Endpoint
N/A

### Parameters
#### Path Parameters
- **base_name** (str) - Required - The base name for the output file.
- **suffix** (str) - Optional - A suffix to append to the file name.
- **extension** (str) - Optional - The file extension.

### Request Example
```python
from hybkit.util import make_out_file_name

output_file = make_out_file_name('my_analysis', suffix='_results', extension='txt')
print(output_file) # Example: my_analysis_results.txt
```

### Response
#### Success Response (str)
- **filename** (str) - The generated output file name.

### Response Example
```json
"my_analysis_results.txt"
```

## validate_args()

### Description
Validates function arguments.

### Method
N/A (Python function)

### Endpoint
N/A

### Parameters
#### Path Parameters
- **args** (dict) - Required - A dictionary of arguments to validate.
- **expected_args** (dict) - Required - A dictionary defining the expected arguments and their types/constraints.

### Request Example
```python
from hybkit.util import validate_args

my_args = {'input': 'data.fasta', 'output': 'results.txt'}
expected = {'input': str, 'output': str}
validate_args(my_args, expected)
```

### Response
#### Success Response (None)
- This function returns None on success.

## validate_args_exit()

### Description
Validates function arguments and exits if validation fails.

### Method
N/A (Python function)

### Endpoint
N/A

### Parameters
#### Path Parameters
- **args** (dict) - Required - A dictionary of arguments to validate.
- **expected_args** (dict) - Required - A dictionary defining the expected arguments and their types/constraints.

### Request Example
```python
from hybkit.util import validate_args_exit

my_args = {'input': 'data.fasta'}
expected = {'input': str, 'output': str}
validate_args_exit(my_args, expected) # Will exit if 'output' is missing
```

### Response
#### Success Response (None)
- This function returns None on success and exits the program on failure.

## set_setting()

### Description
Sets a specific configuration setting.

### Method
N/A (Python function)

### Endpoint
N/A

### Parameters
#### Path Parameters
- **key** (str) - Required - The key of the setting to set.
- **value** (any) - Required - The value to assign to the setting.

### Request Example
```python
from hybkit.util import set_setting

set_setting('log_level', 'INFO')
```

### Response
#### Success Response (None)
- This function returns None.

## set_settings_from_namespace()

### Description
Sets multiple configuration settings from a namespace object.

### Method
N/A (Python function)

### Endpoint
N/A

### Parameters
#### Path Parameters
- **namespace** (object) - Required - An object containing settings as attributes.

### Request Example
```python
from hybkit.util import set_settings_from_namespace

class Config:
    def __init__(self):
        self.threads = 4
        self.verbose = True

config = Config()
set_settings_from_namespace(config)
```

### Response
#### Success Response (None)
- This function returns None.
```

--------------------------------

### Include Records with a Specific First Segment Type

Source: https://github.com/rennelab/hybkit/blob/master/docs/source/toolkit/hyb_filter.md

Use `--include` with a specific segment index like `seg1_type` to filter based on the type of the first segment (5' end). This example includes records where the first segment type is 'mRNA'.

```bash
hyb_filter -i my_file_1.hyb --include seg1_type mRNA
```

--------------------------------

### Match ALL Filtering Criteria

Source: https://github.com/rennelab/hybkit/blob/master/docs/source/toolkit/hyb_filter.md

When using multiple `--filter` or `--filter_2` options, the default behavior is 'any' match. To require all criteria to be met, use `--filter_mode all`. This example outputs records where the segment identifier contains 'kshv' AND the segtype is 'miRNA'.

```bash
hyb_filter -i my_file_1.hyb -f my_file_1.vienna \
              --filter seg_contains kshv \
              --filter_2 seg_type miRNA
```

--------------------------------

### Download Hybkit Package

Source: https://github.com/rennelab/hybkit/blob/master/docs/index.md

Alternatively, download the zipped package using curl and unzip it.

```bash
$ curl -OL https://github.com/RenneLab/hybkit/archive/master.zip
$ unzip master.zip
```

--------------------------------

### Iterate and Print Hyb IDs from File

Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.md

Shows how to open a hyb-format file using HybFile and iterate through each record to print its unique identifier. This utilizes the HybRecord.from_line() constructor internally.

```python
with hybkit.HybFile('path/to/file.hyb', 'r') as hyb_file:
    # performs "hyb_record = hybkit.HybRecord.from_line(line)" for each line in file
    for hyb_record in hyb_file:
        print(hyb_record.id)
```

--------------------------------

### Include Records with Segment Types Containing a Substring

Source: https://github.com/rennelab/hybkit/blob/master/docs/source/toolkit/hyb_filter.md

Use `--include` with `seg_type_contains` to filter records where the segment type string contains a specified substring. This example includes records with segment types containing 'RNA'. Multiple input files can be processed.

```bash
hyb_filter -i my_file_1.hyb my_file_2.hyb -f my_file_1.vienna my_file_2.vienna \
    --include seg_type_contains RNA
```

--------------------------------

### set_settings_from_namespace

Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.util.md

Updates multiple settings at once using an argparse namespace object.

```APIDOC
## set_settings_from_namespace

### Description
Takes a namespace object as from an argparse parser and updates settings accordingly.

### Parameters
#### Arguments
- **nspace** (argparse.Namespace) - Required - Namespace containing settings.
- **verbose** (bool) - Optional - If True, print when changing setting.
```

--------------------------------

### Class: hybkit.CtFile

Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.md

Initializes a CtFile wrapper to iterate over .ct file records.

```APIDOC
## Class hybkit.CtFile

### Description
Ct file wrapper that returns ".ct" file lines as FoldRecord objects. Note: This class is in beta stage.

### Parameters
- **seq_type** (str) - Optional - Type of FoldRecord to return: 'static' or 'dynamic'.
- **error_mode** (str) - Optional - Error handling mode: 'raise', 'warn_return', or 'return'.
- **from_file_like** (bool) - Optional - If True, treats the first argument as a file-like object.
- **args** (Any) - Optional - Passed to open().
- **kwargs** (Any) - Optional - Passed to open().
```

--------------------------------

### Initialize Analysis Class

Source: https://context7.com/rennelab/hybkit/llms.txt

Initialize the Analysis class with desired analysis types and a name. Records can be added individually or in batches.

```python
import hybkit

# Initialize analysis with desired types
analysis = hybkit.analysis.Analysis(
    analysis_types=['type', 'mirna', 'target'],
    name='My_Experiment'
)

# Add records to analysis
with hybkit.HybFile('data.hyb', 'r') as hyb_file:
    for hyb_record in hyb_file:
        hyb_record.eval_types()
        hyb_record.eval_mirna()
        analysis.add_hyb_record(hyb_record)

# Or add all records at once with auto-evaluation
with hybkit.HybFile('data.hyb', 'r') as hyb_file:
    records = hyb_file.read_records()
    analysis.add_hyb_records(records, eval_types=True, eval_mirna=True)

# Get all results
results = analysis.get_all_results()
print(f"Type analysis count: {results['type']['types_analysis_count']}")
print(f"Hybrid types: {results['type']['hybrid_types'].most_common(5)}")
print(f"miRNAs with 5p position: {results['mirna']['mirnas_5p']}")
print(f"Top targets: {results['target']['target_names'].most_common(10)}")

# Get specific result
mirna_count = analysis.get_specific_result('has_mirna')
print(f"Records with miRNA: {mirna_count}")

# Write results to CSV files
analysis.write_analysis_results_special(out_basename='results/experiment')
# Creates: results/experiment_type_hybrid_types.csv,
#          results/experiment_mirna_results.csv,
#          results/experiment_target_names.csv, etc.

# Generate plots
analysis.plot_analysis_results(out_basename='results/experiment')
# Creates: results/experiment_types_hybrid_types.png,
#          results/experiment_target_names.png, etc.
```

--------------------------------

### Iterate Over Paired Hyb and Fold Files

Source: https://context7.com/rennelab/hybkit/llms.txt

Synchronize iteration over paired hyb and fold files. Optionally combine them into unified HybRecord objects with attached fold information.

```python
import hybkit

# Iterate over paired hyb and fold files
with hybkit.HybFile('data.hyb', 'r') as hyb_file, \
     hybkit.ViennaFile('data.vienna', 'r') as vienna_file:

    # Option 1: Get separate records
    fold_iter = hybkit.HybFoldIter(hyb_file, vienna_file, combine=False)
    for hyb_record, fold_record in fold_iter:
        print(f"Hyb: {hyb_record.id}, Fold energy: {fold_record.energy}")

# Option 2: Combine fold into hyb record (recommended)
with hybkit.HybFile('data.hyb', 'r') as hyb_file, \
     hybkit.ViennaFile('data.vienna', 'r') as vienna_file:

    fold_iter = hybkit.HybFoldIter(hyb_file, vienna_file, combine=True)
    for hyb_record in fold_iter:
        # fold_record is now attached to hyb_record
        print(f"ID: {hyb_record.id}")
        print(f"Fold: {hyb_record.fold_record.fold}")
        print(f"Energy: {hyb_record.fold_record.energy}")

        # Get miRNA fold pattern if miRNA present
        hyb_record.eval_types()
        hyb_record.eval_mirna()
        if hyb_record.prop('has_mirna') and hyb_record.prop('mirna_not_dimer'):
            mirna_fold = hyb_record.mirna_details('mirna_fold')
            print(f"miRNA fold: {mirna_fold}")

# Print iteration report
fold_iter.print_report()
```

--------------------------------

### HybFoldIter Class

Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.md

Documentation for the HybFoldIter class, for concurrent iteration over HybFile and ViennaFile/CtFile.

```APIDOC
## hybkit.HybFoldIter

### Description
Class for concurrent iteration over a [`HybFile`](#hybkit.HybFile) and a [`ViennaFile`](#hybkit.ViennaFile) or [`CtFile`](#hybkit.CtFile).

### Class Signature
```python
class hybkit.HybFoldIter(hyb_file: HybFile, fold_file: ViennaFile | CtFile)
```

### Parameters
#### Path Parameters
- **hyb_file** (HybFile) - Required - An opened `HybFile` object.
- **fold_file** (ViennaFile | CtFile) - Required - An opened `ViennaFile` or `CtFile` object.

### Example Usage
```python
# Assuming hyb_file_path and vienna_file_path are valid file paths
# with hybkit.HybFile(hyb_file_path, 'r') as hyb_f, \
#      hybkit.ViennaFile(vienna_file_path, 'r') as vienna_f:
#     hyb_fold_iter = hybkit.HybFoldIter(hyb_f, vienna_f)
#     for hyb_record, fold_record in hyb_fold_iter:
#         print(f"Hyb ID: {hyb_record.id}, Structure: {fold_record.structure}")
```
```

--------------------------------

### Initialize Fold Analysis

Source: https://context7.com/rennelab/hybkit/llms.txt

Initialize fold analysis for RNA secondary structure binding patterns. Requires fold_record and eval_mirna to be set.

```python
import hybkit

# Initialize fold analysis (requires fold_record and eval_mirna)
analysis = hybkit.analysis.Analysis(
    analysis_types=['fold'],
    name='Fold_Analysis'
)

with hybkit.HybFile('data.hyb', 'r') as hyb_file, \
     hybkit.ViennaFile('data.vienna', 'r') as vienna_file:

    fold_iter = hybkit.HybFoldIter(hyb_file, vienna_file, combine=True)

    for hyb_record in fold_iter:
        hyb_record.eval_types()
        hyb_record.eval_mirna()

        # Only add miRNA-containing records with fold info
        if hyb_record.prop('has_mirna'):
            analysis.add_hyb_record(hyb_record)

# Get fold results
fold_results = analysis.get_analysis_results('fold')
print(f"Folds analyzed: {fold_results['fold_analysis_count']}")
print(f"Match count distribution: {fold_results['fold_match_counts']}")
print(f"Per-nucleotide binding counts: {fold_results['mirna_nt_fold_counts']}")
print(f"Per-nucleotide binding proportions: {fold_results['mirna_nt_fold_props']}")

# Write and plot
analysis.write_analysis_results_special(out_basename='fold_results')
analysis.plot_analysis_results(out_basename='fold_results')
# Creates fold histograms showing binding patterns by miRNA position
```

--------------------------------

### Provide specific output file names

Source: https://github.com/rennelab/hybkit/blob/master/docs/source/toolkit/hyb_check.md

Overrides automatic naming by providing explicit output file paths.

```default
hyb_script [...] --out_hyb MY_OUT_DIR/OUT_FILE_1.HYB MY_OUT_DIR/OUT_FILE_2.HYB
    -->  MY_OUT_DIR/OUT_FILE_1.hyb
    -->  MY_OUT_DIR/OUT_FILE_2.hyb
```

--------------------------------

### View hyb_eval usage help

Source: https://github.com/rennelab/hybkit/blob/master/docs/source/toolkit/hyb_eval.md

Displays the full command-line interface usage and available arguments for hyb_eval.

```bash
usage: hyb_analysis [-h] -i PATH_TO/MY_FILE.HYB [PATH_TO/MY_FILE.HYB ...]
                    [-f [PATH_TO/MY_FILE.VIENNA [PATH_TO/MY_FILE.VIENNA ...]]]
                    [-o PATH_TO/OUT_FILE.HYB [PATH_TO/OUT_FILE.HYB ...]]
                    [-l PATH_TO/OUT_FILE.VIENNA [PATH_TO/OUT_FILE.VIENNA ...]]
                    [-d OUT_DIR] [-u OUT_SUFFIX]
                    [-t {type,mirna} [{type,mirna} ...]]
                    [--type_method {hybformat,string_match,id_map}]
                    [--type_params_file PATH_TO/PARAMETERS_FILE]
                    [--set_dataset] [--version] [-v | -s]
                    [--mirna_types MIRNA_TYPES [MIRNA_TYPES ...]]
                    [--custom_flags CUSTOM_FLAGS [CUSTOM_FLAGS ...]]
                    [--hyb_placeholder HYB_PLACEHOLDER]
                    [--reorder_flags {True,False}]
                    [--allow_undefined_flags [{True,False}]]
                    [--allow_unknown_seg_types [{True,False}]]
                    [--hybformat_id [{True,False}]]
                    [--hybformat_ref [{True,False}]]
                    [--allowed_mismatches ALLOWED_MISMATCHES]
                    [--fold_placeholder FOLD_PLACEHOLDER]
                    [-y {static,dynamic}]
                    [--error_mode {raise,warn_return,return}]
                    [--error_checks {hybrecord_indel,foldrecord_nofold,max_mismatch,energy_mismatch} [{hybrecord_indel,foldrecord_nofold,max_mismatch,energy_mismatch} ...]]
                    [--iter_error_mode {raise,warn_return,warn_skip,skip,return}]
                    [--max_sequential_skips MAX_SEQUENTIAL_SKIPS]
```

--------------------------------

### HybFile Class Method: open

Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.md

A class method to open a path to a text file using the built-in `open()` function and return a HybFile object.

```APIDOC
## *classmethod* hybkit.HybFile.open(path: str, *args: Any, hybformat_id: bool | None = None, hybformat_ref: bool | None = None, **kwargs: Any) -> Self

### Description
Open a path to a text file using `open()` and return a HybFile object. Arguments match those of the Python3 built-in `open()` function and are passed directly to it. This method is provided as a convenience function for drop-in replacement of the built-in `open()` function.

### Parameters
#### Path Parameter
- **path** (str) - Required - Path to file to open.

#### HybFile-Specific Keyword Arguments
- **hybformat_id** (bool, optional) - If `True`, during parsing of lines read count information from identifier in `<read_number>_<read_count>` format. Defaults to value in `settings['hybformat_id']`.
- **hybformat_ref** (bool, optional) - If `True`, during parsing of lines read additional record information from identifier in `<gene_id>_<transcript_id>_<gene_name>_<seg_type>` format. Defaults to value in `settings['hybformat_ref']`.

#### Other Parameters
- **\*args** - Passed directly to `open()`.
- **\*\*kwargs** - Passed directly to `open()`.

### Returns
- **HybFile** object.

### Example Usage
```python
with HybFile.open('path/to/file.hyb', 'r') as hyb_file:
    for record in hyb_file:
        print(record)
```

```

--------------------------------

### Open and Read HybFile

Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.md

Opens a hyb-format file for reading and iterates through its records. Use this for processing existing hyb files.

```python
with HybFile.open('path/to/file.hyb', 'r') as hyb_file:
    for record in hyb_file:
        print(record)
```

--------------------------------

### Clone Hybkit Repository

Source: https://github.com/rennelab/hybkit/blob/master/docs/index.md

Use git to clone the project's Github repository.

```bash
$ git clone git://github.com/RenneLab/hybkit
```

--------------------------------

### Download Hyb Data

Source: https://github.com/rennelab/hybkit/blob/master/docs/example_01_link.md

Use this command to download and uncompress the necessary Hyb data files for the analysis. The unpacked data requires approximately 2 GB of disk space.

```default
$ sh ./download_data.sh
```

--------------------------------

### Customize output directory

Source: https://github.com/rennelab/hybkit/blob/master/docs/source/toolkit/hyb_check.md

Specifies a custom output directory for generated files.

```default
hyb_script -i PATH_TO/MY_FILE_1.HYB [...] --out_dir MY_OUT_DIR
    -->  MY_OUT_DIR/MY_FILE_1_ADDSUFFIX.HYB
```

--------------------------------

### Configure string match parameters

Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.type_finder.md

Defines search patterns for identifying segment types based on string matching criteria.

```default
params = {'endswith': [('_miR', 'microRNA'),
                       ('_trans', 'mRNA')   ]}
```

```default
#comment line
#search_type,search_string,seg_type
endswith,_miR,microRNA
endswith,_trans,mRNA
```

--------------------------------

### Run Command-Line Script Tests

Source: https://github.com/rennelab/hybkit/blob/master/docs/index.md

Execute the auto_test.sh script located in the auto_tests directory to test command-line scripts.

```bash
$ ./auto_tests/auto_test.sh
```

--------------------------------

### Generate string match parameters from CSV

Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.type_finder.md

Creates a parameter dictionary for method_string_match from a CSV legend file.

```default
{'endswith': [('_miR', 'microRNA'),
              ('_trans', 'mRNA')   ]}
```

--------------------------------

### Hybkit Settings Definitions

Source: https://github.com/rennelab/hybkit/blob/master/docs/source/hybkit.settings.md

Configuration settings for core Hybkit classes.

```APIDOC
## Hybkit Settings

### HybFile_settings
- **hybformat_id** (bool) - Default: False
- **hybformat_ref** (bool) - Default: False

### FoldRecord_settings
- **allowed_mismatches** (int) - Default: 0
- **error_mode** (str) - Default: 'raise'
- **fold_placeholder** (str) - Default: '.'
- **seq_type** (str) - Default: 'static'

### FoldFile_settings
- (Empty dictionary)

### HybFoldIter_settings
- **error_checks** (list) - Default: ['hybrecord_indel', 'foldrecord_nofold', 'max_mismatch', 'energy_mismatch']
- **iter_error_mode** (str) - Default: 'warn_skip'
- **max_sequential_skips** (int) - Default: 100

### Analysis_settings
- **out_delim** (str) - Default: ','
- **quant_mode** (str) - Default: 'single'
```