### Locatable XSV Configuration Example

Source: https://github.com/broadinstitute/gatk/blob/master/docs/funcotator/forum_info/forum_post_tutorial.md

Configuration for a locatable XSV file, including source details, type, delimiter, and specific columns for contig, start, and end positions.

```properties
name = Oreganno
version = 20160119
src_file = oreganno.tsv
origin_location = http://www.oreganno.org/dump/ORegAnno_Combined_2016.01.19.tsv
preprocessing_script = getOreganno.py
isB37DataSource = false
type = locatableXSV
xsv_delimiter = 	
xsv_permissive_cols = true
contig_column = 1
start_column = 2
end_column = 3
```

--------------------------------

### Example Funcotator WDL JSON Configuration

Source: https://github.com/broadinstitute/gatk/blob/master/scripts/funcotator_wdl/README.md

This JSON file provides a template for configuring the Funcotator WDL script. It includes essential parameters for specifying the GATK Docker image, reference genome files, data sources, and input/output variant files. This example is a starting point and may require modification for specific use cases.

```json
{
  "Funcotator.gatk_docker": "broadinstitute/gatk:latest",
  
  "Funcotator.ref_fasta": "gs://broad-references/hg38/v0/Homo_sapiens_assembly38.fasta",
  "Funcotator.ref_fasta_index": "gs://broad-references/hg38/v0/Homo_sapiens_assembly38.fasta.fai",
  "Funcotator.ref_dict": "gs://broad-references/hg38/v0/Homo_sapiens_assembly38.dict",
  
  "Funcotator.reference_version": "hg38",
  "Funcotator.output_format": "VCF",

  "Funcotator.compress": "false",
  "Funcotator.use_gnomad": "false",
  "Funcotator.data_sources_tar_gz": "gs://gcp-public-data--broad-references/funcotator/funcotator_dataSources.v1.6.20190124s.tar.gz",

  "Funcotator.variant_vcf_to_funcotate": "variants.vcf",
  "Funcotator.variant_vcf_to_funcotate_index": "variants.vcf.idx",
  
  "Funcotator.output_file_base_name": "variants.funcotated"
}
```

--------------------------------

### Cloud Data Source Configuration Example

Source: https://github.com/broadinstitute/gatk/blob/master/docs/funcotator/forum_info/forum_post_tutorial.md

Example of configuring a Funcotator data source where the source file is located on the cloud, specified by a URL in the 'src_file' property.

```properties
...
src_file = gs://broad-references/hg19/v0/1000G_phase1.snps.high_confidence.b37.vcf.gz
...
```

--------------------------------

### Simple XSV Configuration File Example

Source: https://github.com/broadinstitute/gatk/blob/master/docs/funcotator/forum_info/forum_post_tutorial.md

Example of a configuration file for a simple XSV data source. This file defines metadata such as name, version, source file, and data type.

```properties
name = Familial_Cancer_Genes
version = 20110905
src_file = Familial_Cancer_Genes.no_dupes.tsv
origin_location = oncotator_v1_ds_April052016.tar.gz
preprocessing_script = UNKNOWN

# Whether this data source is for the b37 reference.
# Required and defaults to false.
isB37DataSource = false

# Supported types:
# simpleXSV    -- Arbitrary separated value table (e.g. CSV), keyed off Gene Name OR Transcript ID
# locatableXSV -- Arbitrary separated value table (e.g. CSV), keyed off a genome location
# gencode      -- Custom datasource class for GENCODE
#	cosmic       -- Custom datasource class for COSMIC
# vcf          -- Custom datasource class for Variant Call Format (VCF) files
type = simpleXSV

# Required field for GENCODE files.
# Path to the FASTA file from which to load the sequences for GENCODE transcripts:
gencode_fasta_path = 

# Required field for GENCODE files.
# NCBI build version (either hg19 or hg38):
ncbi_build_version = 

```

--------------------------------

### Install PAT Dependencies

Source: https://github.com/broadinstitute/gatk/wiki/Running-Intel-PAT-on-Dataproc

Install necessary dependencies for Intel PAT on each machine in the cluster. These commands should be run after SSHing into each node.

```bash
$ apt-get install perf-tools-unstable
```

```bash
$ apt-get install gawk
```

```bash
$ apt-get install sysstat
```

--------------------------------

### Install Intel PAT

Source: https://github.com/broadinstitute/gatk/wiki/Running-Intel-PAT-on-Dataproc

Execute this command on the master node after configuring the PAT config file to install PAT across the cluster.

```bash
$ ./pat install
```

--------------------------------

### Install Temurin JDK 17 with Homebrew

Source: https://github.com/broadinstitute/gatk/wiki/Switching-to-Java-17

Use Homebrew to tap the cask versions and install Temurin JDK 17. This is the recommended JDK for GATK.

```bash
brew tap homebrew/cask-versions
```

```bash
brew install --cask temurin17
```

--------------------------------

### Simple XSV Configuration Example

Source: https://github.com/broadinstitute/gatk/blob/master/docs/funcotator/forum_info/forum_post_tutorial.md

Configuration for a simple XSV file, specifying the key, key column, delimiter, and permissive column matching.

```properties
xsv_key = GENE_NAME
xsv_key_column = 2
xsv_delimiter = 	
xsv_permissive_cols = true
```

--------------------------------

### Run a Standard GATK4 Tool

Source: https://github.com/broadinstitute/gatk/blob/master/README.md

Example of running a non-Spark GATK4 tool, `PrintReads`, with input and output BAM files specified.

```bash
./gatk PrintReads -I input.bam -O output.bam
```

--------------------------------

### Get GATK Help

Source: https://github.com/broadinstitute/gatk/blob/master/README.md

Access general help information for running the GATK by invoking the --help flag.

```bash
./gatk --help
```

--------------------------------

### Run a Spark-based GATK4 Tool

Source: https://github.com/broadinstitute/gatk/blob/master/README.md

Example of running a Spark-enabled GATK4 tool, `PrintReadsSpark`, with input and output BAM files specified.

```bash
./gatk PrintReadsSpark -I input.bam -O output.bam
```

--------------------------------

### Install Miniconda

Source: https://github.com/broadinstitute/gatk/blob/master/README.md

Install Miniconda to a specified location on your PATH. This command assumes you have downloaded the installer script.

```bash
bash Miniconda3-py310_23.10.0-1-[YOUR_OS].sh -p /opt/miniconda -b
```

--------------------------------

### Test GATK4 Docker Image

Source: https://github.com/broadinstitute/gatk/wiki/How-to-release-GATK4

Verify your Docker setup by pulling the latest GATK4 image and running it interactively. This ensures Docker is installed correctly and can access GATK4 images.

```bash
docker pull broadinstitute/gatk:latest
docker run -it broadinstitute/gatk:latest
```

--------------------------------

### Install Git LFS

Source: https://github.com/broadinstitute/gatk/blob/master/README.md

Install Git Large File Storage (LFS) to download large files required for GATK. Run this command after downloading Git LFS.

```bash
git lfs install
```

--------------------------------

### Command Line Program Annotation Example

Source: https://github.com/broadinstitute/gatk/wiki/GATK4-Documentation-Generation

Example of Javadoc annotations for a GATK command-line program. `@CommandLineProgramProperties` provides metadata, and `@DocumentedFeature` tags the class for inclusion in documentation.

```java
@CommandLineProgramProperties(
   summary = "Prints reads from the input SAM/BAM/CRAM file to the SAM/BAM/CRAM file.",
   oneLineSummary = "Print reads in the SAM/BAM/CRAM file",
   programGroup = ReadProgramGroup.class
)
@DocumentedFeature
public final class PrintReads extends ReadWalker {...
```

--------------------------------

### Get Help for a Specific GATK4 Tool

Source: https://github.com/broadinstitute/gatk/blob/master/README.md

Use this command to display detailed help and usage information for any specific GATK4 tool.

```bash
./gatk ToolName --help
```

--------------------------------

### Reference Context Example

Source: https://github.com/broadinstitute/gatk/blob/master/docs/funcotator/forum_info/forum_post_annotation_specifications.md

Illustrates the reference coding sequence in a window around a variant, showing strand-correctness. The window size defaults to 10 bases.

```text
         [REF ALLELE]
              |
              v
    GAACCCACGTCGGTGAGGGCC
    |________| |________|
        v           v
     10 bases      10 bases
   (window size)  (window size)
```

```text
         [REF ALLELE]
              |
              v
    CACGAAAGTCGTTGCGGATCT
    |________| |________|
        v           v
     10 bases      10 bases
   (window size)  (window size)
```

--------------------------------

### Perform a Full GATK4 Build

Source: https://github.com/broadinstitute/gatk/blob/master/README.md

Run this command to create a complete, standalone GATK distribution zip archive. This includes the launcher, local and Spark jars, and documentation. The resulting archive is found in the `build/` directory.

```bash
./gradlew bundle
```

```bash
./gradlew
```

--------------------------------

### Prepare Directory on gsaweb Server

Source: https://github.com/broadinstitute/gatk/wiki/Forum-How-to-update-gatk-tools-doc-to-default-to-the-latest-version

Navigate to the tool docs directory on the gsaweb server and create a new directory for the specific version of the documentation you are deploying.

```bash
cd /local/htdocs/gatk/documentation/tooldocs/
mkdir 4.0.12.0
```

--------------------------------

### Dockerfile for GATK Development Environment

Source: https://github.com/broadinstitute/gatk/wiki/How-to-set-up-and-use-cloud-dev-environment

This Dockerfile sets up a Java 8 JDK environment, installs essential tools like Python, pip, R, GCC, Git, and Google Cloud SDK. It also configures crcmod for gsutil and installs Git LFS. Finally, it updates Google Cloud SDK components and installs the ggplot2 R package.

```dockerfile
#Use a jdk, not a JRE because we want to compile things
FROM java:8-jdk
MAINTAINER DSDE <dsde@broadinstitute.org>
ENV TERM=xterm-256color
  
# Install python2, python3, and R, etc
RUN apt-get update && \
    apt-get upgrade -y && \
    apt-get install -y python && \
    apt-get install -y python3-pip && \
    apt-get install -y r-base wget curl unzip gcc python-dev python-setuptools emacs git less lynx hdfview
 
#Make sure we're using crcmod in gsutil
RUN easy_install -U pip
RUN pip install -U crcmod
 
# Install GIT LFS
RUN wget https://github.com/github/git-lfs/releases/download/v1.2.0/git-lfs-linux-386-1.2.0.tar.gz \
    && tar -zxvf git-lfs-linux-386-1.2.0.tar.gz \
    && cd git-lfs-1.2.0 && ./install.sh && cd ..
 
RUN wget https://dl.google.com/dl/cloudsdk/release/google-cloud-sdk.zip \
    && unzip google-cloud-sdk.zip \
    && rm google-cloud-sdk.zip
 
RUN google-cloud-sdk/install.sh --usage-reporting=true --path-update=true --bash-completion=true --rc-path=/.bashrc --disable-installation-options
VOLUME ["/root/.config"]
ENV PATH /google-cloud-sdk/bin:$PATH
 
RUN yes | gcloud components update
RUN yes | gcloud components update preview
 
WORKDIR /usr/gitc
 
# Install ggplot2
RUN echo 'install.packages(c("ggplot2"), repos="http://cran.us.r-project.org", dependencies=TRUE)' > /tmp/packages.R && Rscript /tmp/packages.R
 
```

--------------------------------

### Build GATK4 Docker Image and Push to Docker Hub

Source: https://github.com/broadinstitute/gatk/blob/master/scripts/docker/README.md

Use this script to create the official GATK4 Docker image and push it to Docker Hub. Requires appropriate access. Allow approximately one hour for completion, including unit tests.

```bash
# REPLACE VALUE OF GITHUB_TAG WITH DESIRED VERSION
export GITHUB_TAG=1.0.0.0-alpha1.2.1

# REPLACE with the directory where you'd like to clone the repo
export STAGING_DIR=~/tmp/tmp_build_docker_image/

sudo bash build_docker.sh -e ${GITHUB_TAG} -p -d ${STAGING_DIR}
```

--------------------------------

### Oncotator Default Configuration Example

Source: https://github.com/broadinstitute/gatk/blob/master/scripts/mutect2_wdl/README.md

Provides an example INI-style configuration file for Oncotator, specifying manual annotations and overrides for TCGA MAF generation. This helps prevent '__UNKNOWN__' values.

```ini
[manual_annotations]
override:NCBI_Build=37,Strand=+,status=Somatic,phase=Phase_I,sequencer=Illumina,Tumor_Validation_Allele1=,Tumor_Validation_Allele2=,Match_Norm_Validation_Allele1=,Match_Norm_Validation_Allele2=,Verification_Status=,Validation_Status=,Validation_Method=,Score=,BAM_file=,Match_Norm_Seq_Allele1=,Match_Norm_Seq_Allele2=
```

--------------------------------

### Run GATK Tool Documentation Generation

Source: https://github.com/broadinstitute/gatk/wiki/GATK4-Documentation-Generation

Execute this Gradle task to generate HTML and JSON documentation files for GATK tools. The output is placed in the 'gatkDoc' directory within the build directory.

```bash
./gradlew gatkDoc
```

--------------------------------

### Fast Build for Local Development

Source: https://github.com/broadinstitute/gatk/blob/master/README.md

Use this command for a quick build that allows running GATK tools only from within your git clone, locally. It's optimized for developers who need rapid iteration.

```bash
./gradlew installDist
```

--------------------------------

### Utility Class Annotation Example

Source: https://github.com/broadinstitute/gatk/wiki/GATK4-Documentation-Generation

Example of Javadoc annotations for a GATK utility class. `@DocumentedFeature` is used here to both tag the class for documentation and provide group information, as it's not a command-line program.

```java
@DocumentedFeature(
groupName=HelpConstants.DOC_CAT_READFILTERS, groupSummary=HelpConstants.DOC_CAT_READFILTERS_SUMMARY)
public final class ReadLengthReadFilter extends ReadFilter implements Serializable{...
```

--------------------------------

### Gencode Annotation: Insertion Example

Source: https://github.com/broadinstitute/gatk/blob/master/docs/funcotator/forum_info/forum_post_annotation_specifications.md

Represents an insertion of bases between two positions in a transcript.

```text
c.2018_2019insAA
```

--------------------------------

### Navigate to GATK Directory

Source: https://github.com/broadinstitute/gatk/blob/master/docs/funcotator/forum_info/forum_post_tutorial.md

Change the current directory to your GATK installation folder. This is a prerequisite for running GATK commands.

```bash
cd ~/gatk
```

--------------------------------

### Gencode Annotation: Single Base Deletion Example

Source: https://github.com/broadinstitute/gatk/blob/master/docs/funcotator/forum_info/forum_post_annotation_specifications.md

Represents the deletion of a single base at a specific position in a transcript.

```text
c2018delT
```

--------------------------------

### Generate GATK Documentation Locally

Source: https://github.com/broadinstitute/gatk/wiki/Forum-How-to-update-gatk-tools-doc-to-default-to-the-latest-version

Navigate to the GATK workspace, pull the latest changes, checkout a specific version, and generate the documentation using Gradle. This is a prerequisite for deploying the updated docs.

```bash
cd ~/Workspace/gatk/
git pull
git checkout _versionnumber_
./gradlew gatkDoc
```

--------------------------------

### Build GATK Base Docker Image (Local)

Source: https://github.com/broadinstitute/gatk/blob/master/scripts/docker/gatkbase/README.md

Builds the GATK base image on your local machine. Provide the new version number as an argument.

```bash
build_docker_base_locally.sh 3.0.0rc1
```

--------------------------------

### Gencode Annotation: Multiple Base Deletion Example

Source: https://github.com/broadinstitute/gatk/blob/master/docs/funcotator/forum_info/forum_post_annotation_specifications.md

Represents the deletion of multiple bases within a specified range in a transcript.

```text
c2018_2022delTTCAG
```

--------------------------------

### Configure Gradle Credentials

Source: https://github.com/broadinstitute/gatk/wiki/How-to-release-GATK4

Add Sonatype and GPG key credentials to your `~/.gradle/gradle.properties` file. Ensure `signing.keyId`, `signing.password`, `signing.secretKeyRingFile`, `sonatypeUsername`, and `sonatypePassword` are correctly set.

```properties
signing.keyId=ID_FOR_YOUR_PUBLIC_KEY
signing.password=PASSPHRASE_FOR_YOUR_KEYPAIR
signing.secretKeyRingFile=PATH_TO_YOUR_SECRET_KEYRING_FILE
sonatypeUsername=YOUR_SONATYPE_TOKEN_USERNAME
sonatypePassword=YOUR_SONATYPE_TOKEN_PASSWORD
```

--------------------------------

### Create BWA-MEM Index Image

Source: https://github.com/broadinstitute/gatk/blob/master/docs/mutect/mutect.tex

Generate a BWA-MEM index image required by FilterAlignmentArtifacts. This is typically a one-time setup step.

```bash
gatk BwaMemIndexCreator -I reference.fasta -O reference.fasta.img
```

--------------------------------

### Generate Documentation in PHP Format

Source: https://github.com/broadinstitute/gatk/wiki/GATK4-Documentation-Generation

Add the '-PphpDoc' flag to the Gradle command to generate documentation in PHP format, suitable for PHP-enabled web servers.

```bash
./gradlew gatkDoc -PphpDoc
```

--------------------------------

### Copy Documentation to gsaweb Server

Source: https://github.com/broadinstitute/gatk/wiki/Forum-How-to-update-gatk-tools-doc-to-default-to-the-latest-version

Securely copy all generated documentation files from your local machine to the designated directory on the gsaweb server.

```bash
scp * bgandham@gsaweb:/local/htdocs/gatk/documentation/tooldocs/4.0.12.0/
```

--------------------------------

### Generate PHP Documentation Locally

Source: https://github.com/broadinstitute/gatk/wiki/Forum-How-to-update-gatk-tools-doc-to-default-to-the-latest-version

Generate PHP documentation for GATK tools using Gradle. The output will be placed in the 'gatkdoc' folder.

```bash
./gradlew -PphpDoc gatkDoc
```

--------------------------------

### Gencode Annotation: Intronic Variant Example

Source: https://github.com/broadinstitute/gatk/blob/master/docs/funcotator/forum_info/forum_post_annotation_specifications.md

Represents a variant occurring in an intron, indicating the offset from the exon boundary and the change in bases.

```text
c.e81-4TAA>A
```

--------------------------------

### Build gatkbase Docker Image Locally

Source: https://github.com/broadinstitute/gatk/blob/master/scripts/docker/README.md

Execute the build script to create the gatkbase Docker image on your local machine. Replace <docker_image_version> with the desired version tag.

```bash
build_docker_base_locally.sh <docker_image_version>
```

--------------------------------

### Gencode Annotation: SNP Example

Source: https://github.com/broadinstitute/gatk/blob/master/docs/funcotator/forum_info/forum_post_annotation_specifications.md

Represents a single nucleotide polymorphism (SNP) where one base is changed to another at a specific position.

```text
c.1507T>G
```

--------------------------------

### Configure Docker Environment for VM

Source: https://github.com/broadinstitute/gatk/wiki/How-to-set-up-and-use-cloud-dev-environment

After creating a virtual host (e.g., 'gatkbuild'), run this command to configure your current shell session to communicate with the Docker daemon running on that VM. This command needs to be re-run if you open a new shell.

```bash
> bash
bash-3.2$ eval "$(docker-machine env gatkbuild)"
```

--------------------------------

### Build GATK4 Release Bundle

Source: https://github.com/broadinstitute/gatk/wiki/How-to-release-GATK4

Clean the project, build the release bundle, and create a zip file for distribution. The release flag enables specific build configurations.

```bash
./gradlew clean bundle -Drelease=true
```