### Dockerfile: Source Compilation Installation

Source: https://context7.com/biocontainers/containers/llms.txt

Example Dockerfile for creating a custom container by compiling a tool from source. Downloads, configures, makes, and installs the software.

```dockerfile
# Example: Source compilation installation
FROM biocontainers/biocontainers:v1.1.0_cv2

LABEL software="mytool"
LABEL software.version="3.0.0"
LABEL about.summary="Compiled bioinformatics tool"

MAINTAINER Your Name <email@example.com>

ENV VERSION=3.0.0
ENV URL=https://github.com/user/mytool/releases/download/v${VERSION}
ENV DST=/home/biodocker/bin

USER root

RUN wget ${URL}/mytool-${VERSION}.tar.gz -O /tmp/mytool.tar.gz && \
    cd /tmp && tar xzf mytool.tar.gz && \
    cd mytool-${VERSION} && \
    ./configure --prefix=/usr/local && \
    make && make install && \
    rm -rf /tmp/*

USER biodocker
WORKDIR /data/
```

--------------------------------

### Dockerfile: Debian Package Installation

Source: https://context7.com/biocontainers/containers/llms.txt

Example Dockerfile for creating a custom container using a Debian package installation pattern. Installs a tool using apt-get.

```dockerfile
# Example: Debian package-based installation
FROM biocontainers/biocontainers:vdebian-buster-backports_cv1

MAINTAINER biocontainers <biodocker@gmail.com>

LABEL software="mytool" \
    base_image="biocontainers/biocontainers:vdebian-buster-backports_cv1" \
    about.summary="Tool description" \
    about.home="https://mytool.org" \
    software.version="2.0-1-deb" \
    about.license="GPL-3"

USER root
ENV DEBIAN_FRONTEND noninteractive
RUN apt-get update && \
    (apt-get install -t buster-backports -y mytool || apt-get install -y mytool) && \
    apt-get clean && \
    apt-get purge && \
    rm -rf /var/lib/apt/lists/* /tmp/*
USER biodocker
```

--------------------------------

### Dockerfile: Conda-Based Installation

Source: https://context7.com/biocontainers/containers/llms.txt

Example Dockerfile for creating a custom container using a Conda-based installation pattern. Installs a tool from the Bioconda channel.

```dockerfile
# Example: Custom tool using Conda installation
FROM biocontainers/biocontainers:v1.1.0_cv2

LABEL base_image="biocontainers:v1.1.0_cv2"
LABEL version="1"
LABEL software="mytool"
LABEL software.version="1.0.0"
LABEL about.summary="Description of my bioinformatics tool"
LABEL about.home="https://github.com/user/mytool"
LABEL about.license="SPDX:MIT"
LABEL about.tags="Genomics"
LABEL extra.binaries="mytool"

MAINTAINER Your Name <your.email@example.com>

# Install from bioconda channel (pre-configured in base image)
RUN conda install mytool=1.0.0

WORKDIR /data/
```

--------------------------------

### Start PyMol Server

Source: https://github.com/biocontainers/containers/blob/master/pymol-jupiter/1.0.0/ipymol/iPyMol_example.ipynb

Initiates the PyMol server process, which is necessary for iPyMol to communicate with PyMol.

```python
pymol.start()
```

--------------------------------

### Execute PyMol Commands

Source: https://github.com/biocontainers/containers/blob/master/pymol-jupiter/1.0.0/ipymol/iPyMol_example.ipynb

A comprehensive example of executing multiple PyMol commands to load a structure, clean it, apply smoothing, color atoms and maps, adjust rendering, and set the camera view. Use `pymol.do()` for each command.

```python
pymol.do('fetch 3uex, struct, async=0;')
pymol.do('remove solvent; ')

# smoothing parameters
pymol.do('alter all, b=10; alter all, q=1; set gaussian_resolution, 7.6;')
pymol.do('map_new map, gaussian, 1, n. C+O+N+CA, 5; isosurface surf, map, 1.5;')

# color struct according to atom count
pymol.do('spectrum count, rainbow, struct')

# color the map based on the b-factors of the underlying protein
pymol.do('cmd.ramp_new("ramp", "struct", [0,10,10], "rainbow") ')
 
# set the surface color
pymol.do('cmd.set("surface_color", "ramp", "surf")')
 
# hide the ramp and lines
pymol.do('disable ramp; hide lines;')

pymol.do('show sticks, org; show spheres, org;')

pymol.do('color magenta, org')
pymol.do('set_bond stick_radius, 0.13, org; set sphere_scale, 0.26, org;')
 
pymol.do('set_bond stick_radius, 0.13, org; set_bond stick_color, white, org; set sphere_scale, 0.26, org;')

pymol.do('set_view (\
    -0.877680123,    0.456324875,   -0.146428943,
    0.149618521,   -0.029365506,   -0.988305628,
    -0.455291569,   -0.889327347,   -0.042500813,
    -0.000035629,    0.000030629,  -37.112102509,
    -3.300258160,    6.586110592,   22.637466431,
     8.231912613,   65.999290466,  -50.000000000 );')

pymol.do('ray;')

pymol.show()
pymol.do('png png0.png;')

```

--------------------------------

### Download InterProScan Databases

Source: https://github.com/biocontainers/containers/blob/master/interproscan/5.30-69.0/README.md

Download and unpack the necessary member databases package for InterProScan. Ensure you have `wget` and `tar` installed.

```bash
wget ftp://ftp.ebi.ac.uk/pub/software/unix/iprscan/5/5.30-69.0/alt/interproscan-data-5.30-69.0.tar.gz
wget ftp://ftp.ebi.ac.uk/pub/software/unix/iprscan/5/5.30-69.0/alt/interproscan-data-5.30-69.0.tar.gz.md5
md5sum -c interproscan-data-5.30-69.0.tar.gz.md5 
tar -zxf interproscan-data-5.30-69.0.tar.gz
```

--------------------------------

### Pull and Run FastQC Container

Source: https://context7.com/biocontainers/containers/llms.txt

Demonstrates pulling the FastQC container and using it to perform quality control analysis on FASTQ files.

```bash
# Pull FastQC container
docker pull biocontainers/fastqc:0.11.9

# Run quality control on FASTQ files
docker run --rm -v /path/to/data:/data biocontainers/fastqc:0.11.9 \
    fastqc /data/reads_1.fq /data/reads_2.fq \
    --outdir /data/qc_reports \
    --threads 2

# Expected output: HTML reports and zip files
# reads_1_fastqc.html
# reads_1_fastqc.zip
# reads_2_fastqc.html
# reads_2_fastqc.zip
```

--------------------------------

### Build ShotMAP Search Database

Source: https://github.com/biocontainers/containers/blob/master/shotmap/1.0.0/README.md

Use this command to build a search database for ShotMAP. This only needs to be done once. Specify the directory for reference data and the desired output directory for the search database.

```bash
perl $SHOTMAP_LOCAL/scripts/build_shotmap_searchdb.pl -r=</directory/path/to/reference/database> -d=</directory/path/to/search/database>
```

--------------------------------

### Build Container Locally

Source: https://context7.com/biocontainers/containers/llms.txt

Builds a Docker container locally from a tool's directory and tests its basic functionality.

```bash
# Navigate to tool directory
cd biocontainers/mytool/1.0.0/

# Build the container
docker build -t biocontainers/mytool:1.0.0 .

# Test the container runs correctly
docker run --rm biocontainers/mytool:1.0.0 mytool --version
# Expected: mytool version 1.0.0

# Run with test data
docker run --rm -v $(pwd)/testdata:/data biocontainers/mytool:1.0.0 \
    mytool --input /data/test.fa --output /data/result.txt

# Verify output
cat testdata/result.txt
```

--------------------------------

### Pull and Run Samtools Container

Source: https://context7.com/biocontainers/containers/llms.txt

Shows how to pull the Samtools container and use it for converting SAM to sorted BAM, indexing, and checking alignment statistics.

```bash
# Pull samtools container
docker pull biocontainers/samtools:1.9-4-deb

# Convert SAM to sorted BAM
docker run --rm -v /path/to/data:/data biocontainers/samtools:1.9-4-deb \
    samtools sort -o /data/aligned.sorted.bam /data/aligned.sam

# Index the BAM file
docker run --rm -v /path/to/data:/data biocontainers/samtools:1.9-4-deb \
    samtools index /data/aligned.sorted.bam

# View alignment statistics
docker run --rm -v /path/to/data:/data biocontainers/samtools:1.9-4-deb \
    samtools flagstat /data/aligned.sorted.bam

# Expected output:
# 1000000 + 0 in total (QC-passed reads + QC-failed reads)
# 950000 + 0 mapped (95.00% : N/A)
# 900000 + 0 properly paired (90.00% : N/A)
```

--------------------------------

### Mount Reference Data with Singularity/Apptainer

Source: https://github.com/biocontainers/containers/blob/master/cadd-scripts-with-envs/1.6.post1/README.md

Use this option with Singularity/Apptainer to mount the reference data directory. Ensure `$REFPATH` points to your downloaded reference data.

```bash
-B $REFPATH:/opt/CADD-scripts-1.6.post1/data/annotations
```

--------------------------------

### Initialize iPyMol and PyMol

Source: https://github.com/biocontainers/containers/blob/master/pymol-jupiter/1.0.0/ipymol/iPyMol_example.ipynb

Ensure plots are displayed inline in Jupyter notebooks and import the iPyMol viewer. This is a prerequisite for using iPyMol.

```python
%pylab inline
from ipymol import viewer as pymol
```

--------------------------------

### Mount Reference Data with Docker

Source: https://github.com/biocontainers/containers/blob/master/cadd-scripts-with-envs/1.6.post1/README.md

Use this option with Docker to mount the reference data directory. Ensure `$REFPATH` points to your downloaded reference data.

```bash
-v $REFPATH:/opt/CADD-scripts-1.6.post1/data/annotations
```

--------------------------------

### Run denovoGUI Container

Source: https://github.com/biocontainers/containers/blob/master/MANIFEST.md

Runs the denovoGUI container. It maps the host's X11 display to the container for GUI access.

```docker
docker run --rm -e DISPLAY=$DISPLAY -v /tmp/.X11-unix:/tmp/.X11-unix biodckr/denovogui
```

--------------------------------

### Pull and Run Bowtie2 Container

Source: https://context7.com/biocontainers/containers/llms.txt

Illustrates pulling the Bowtie2 container and using it to build an index from a reference genome and align sequencing reads.

```bash
# Pull bowtie2 container
docker pull biocontainers/bowtie2:2.4.1

# Build bowtie2 index from reference
docker run --rm -v /path/to/data:/data biocontainers/bowtie2:2.4.1 \
    bowtie2-build /data/reference.fa /data/reference_index

# Align reads to indexed reference
docker run --rm -v /path/to/data:/data biocontainers/bowtie2:2.4.1 \
    bowtie2 -x /data/reference_index \
    -1 /data/reads_1.fq -2 /data/reads_2.fq \
    -S /data/bowtie2_output.sam \
    --threads 4

# Expected output includes alignment rate summary:
# 1000000 reads; of these:
#   1000000 (100.00%) were paired
#   950000 (95.00%) aligned concordantly exactly 1 time
```

--------------------------------

### Pull and Run BWA Container

Source: https://context7.com/biocontainers/containers/llms.txt

Demonstrates how to pull the BWA container and use it for indexing a reference genome and performing paired-end alignment.

```bash
# Pull BWA container from Docker Hub
docker pull biocontainers/bwa:0.7.17

# Run BWA to index a reference genome
docker run --rm -v /path/to/data:/data biocontainers/bwa:0.7.17 \
    bwa index /data/reference.fa

# Perform paired-end alignment
docker run --rm -v /path/to/data:/data biocontainers/bwa:0.7.17 \
    bwa mem -t 4 /data/reference.fa /data/reads_1.fq /data/reads_2.fq > /data/aligned.sam

# Expected output: SAM file with aligned reads
# @SQ SN:chr1   LN:248956422
# @PG ID:bwa    PN:bwa  VN:0.7.17-r1188
# read1   0   chr1    10000   60  100M    *   0   0   ACGT...
```

--------------------------------

### Convert and Sort BAM with Samtools using Docker

Source: https://context7.com/biocontainers/containers/llms.txt

Converts aligned SAM to sorted BAM format and indexes it using Samtools within a Docker container. Requires the aligned SAM file as input.

```bash
docker run --rm -v ${DATA_DIR}:/data biocontainers/samtools:1.9-4-deb \
    sh -c "samtools sort -@ 4 -o /data/aligned.sorted.bam /data/aligned.sam && \
           samtools index /data/aligned.sorted.bam"
```

--------------------------------

### Build BioDocker Base Image

Source: https://github.com/biocontainers/containers/blob/master/MANIFEST.md

Builds the BioDocker base image from scratch. Use this as a foundation for other bioinformatics tools.

```docker
docker build --rm -t biodckr/biodocker .
```

--------------------------------

### Run NCBI BLAST+ Container

Source: https://github.com/biocontainers/containers/blob/master/MANIFEST.md

Runs the NCBI BLAST+ container. Replace <options> and <files> with your specific BLAST parameters and input files.

```docker
docker run --rm biodckr/ncbi-blast <options> <files>
```

--------------------------------

### Execute ShotMAP Pipeline

Source: https://github.com/biocontainers/containers/blob/master/shotmap/1.0.0/README.md

Run the main ShotMAP pipeline to process metagenomic sequences. Provide the input directory for metagenomes, the path to the search database, and the output directory for results.

```bash
perl $SHOTMAP_LOCAL/scripts/shotmap.pl -i=</directory/path/to/metagenomes> -d=</directory/path/to/search/database> -o=</directory/path/to/result/database/>
```

--------------------------------

### Run InterProScan Docker Container

Source: https://github.com/biocontainers/containers/blob/master/interproscan/5.30-69.0/README.md

Execute the InterProScan Docker container to analyze a FASTA file. Mounts the current directory for input/output and the InterProScan data directory. Requires Docker.

```bash
docker run --rm --name interproscan -v $PWD:/data -v $PWD/interproscan-5.30-69.0/data:/opt/interproscan/data biocontainers/interproscan:v5.30-69.0_cv1 ./interproscan.sh -dp -f tsv -o /data/test_out.ipr -i test_proteins.fasta
```

--------------------------------

### Call Variants with BCFtools using Docker

Source: https://context7.com/biocontainers/containers/llms.txt

Calls variants from sorted BAM files using BCFtools within a Docker container. Generates a VCF.gz file and its index.

```bash
docker run --rm -v ${DATA_DIR}:/data biocontainers/bcftools:1.9-1-deb \
    sh -c "bcftools mpileup -f /data/reference.fa /data/aligned.sorted.bam | \
           bcftools call -mv -Oz -o /data/variants.vcf.gz && \
           bcftools index /data/variants.vcf.gz"
```

--------------------------------

### Mount Reference Data for Singularity/Apptainer

Source: https://github.com/biocontainers/containers/blob/master/cadd-scripts-with-envs/1.6/README.md

Use this option with Singularity/Apptainer to mount the directory containing CADD-scripts reference data to the container. Ensure `$REFPATH` points to your downloaded reference data.

```bash
-B $REFPATH:/opt/conda/share/cadd-scripts-1.6-1/data/annotations
```

--------------------------------

### Build denovoGUI Container

Source: https://github.com/biocontainers/containers/blob/master/MANIFEST.md

Builds the denovoGUI container image. This image is based on biodckr/biodocker:latest.

```docker
docker build --rm -t biodckr/denovogui 1.5.2/.
```

--------------------------------

### Run DIA-Umpire Container

Source: https://github.com/biocontainers/containers/blob/master/MANIFEST.md

Runs the DIA-Umpire container for mass spectrometry data analysis.

```docker
docker run --rm biodckr/diaumpire
```

--------------------------------

### Run EMBOSS Container

Source: https://github.com/biocontainers/containers/blob/master/MANIFEST.md

Runs the EMBOSS container, a software package for molecular biology analysis.

```docker
docker run --rm biodckr/emboss
```

--------------------------------

### Mount Reference Data for Docker

Source: https://github.com/biocontainers/containers/blob/master/cadd-scripts-with-envs/1.6/README.md

Use this option with Docker to mount the directory containing CADD-scripts reference data to the container. Ensure `$REFPATH` points to your downloaded reference data.

```bash
-v $REFPATH:/opt/conda/share/cadd-scripts-1.6-1/data/annotations
```

--------------------------------

### Pull denovoGUI Container

Source: https://github.com/biocontainers/containers/blob/master/MANIFEST.md

Pulls the denovoGUI container image.

```docker
docker pull biodckr/denovogui
```

--------------------------------

### Pull BWA container from Quay.io

Source: https://context7.com/biocontainers/containers/llms.txt

Pulls the BWA container image with version 0.7.17 from Quay.io, an alternative registry supporting rkt.

```bash
docker pull quay.io/biocontainers/bwa:0.7.17
```

--------------------------------

### Trim Adapters with Cutadapt

Source: https://context7.com/biocontainers/containers/llms.txt

Trims Illumina adapters from paired-end FASTQ reads using the Cutadapt BioContainer. Mounts the data directory to /data within the container.

```bash
docker run --rm -v /path/to/data:/data biocontainers/cutadapt:1.18-1-deb-py3 \
    cutadapt \
    -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA \
    -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT \
    -o /data/trimmed_1.fq -p /data/trimmed_2.fq \
    /data/reads_1.fq /data/reads_2.fq \
    --minimum-length 20
```

--------------------------------

### Quality Trimming with Cutadapt

Source: https://context7.com/biocontainers/containers/llms.txt

Performs quality trimming from the 3' end of FASTQ reads using the Cutadapt BioContainer. Mounts the data directory to /data within the container.

```bash
docker run --rm -v /path/to/data:/data biocontainers/cutadapt:1.18-1-deb-py3 \
    cutadapt -q 20 -o /data/quality_trimmed.fq /data/reads.fq
```

--------------------------------

### Compare ShotMAP Results

Source: https://github.com/biocontainers/containers/blob/master/shotmap/1.0.0/README.md

Compare results from multiple ShotMAP runs. This command takes the directory containing result databases, an optional metadata file, and an output directory for the comparison results.

```bash
perl $SHOTMAP_LOCAL/scripts/compare_shotmap_results.pl -i=</directory/path/to/result/database/> -m=</path/to/optional/metadata/file> -o=</directory/path/to/new/result/directory/>
```

--------------------------------

### Align Reads with BWA using Docker

Source: https://context7.com/biocontainers/containers/llms.txt

Aligns FASTQ reads to a reference genome using BWA within a Docker container. Ensure the data directory is mounted correctly.

```bash
docker run --rm -v ${DATA_DIR}:/data biocontainers/bwa:0.7.17 \
    bwa mem -t 8 /data/reference.fa \
    /data/trimmed_R1.fq.gz /data/trimmed_R2.fq.gz > ${DATA_DIR}/aligned.sam
```

--------------------------------

### Run Crux Container

Source: https://github.com/biocontainers/containers/blob/master/MANIFEST.md

Runs the Crux container. The command accepts specific Crux tools like './crux', './xlink-assign-ions', or './xlink-score-spectrum'.

```docker
docker run --rm biodckr/crux [./crux ./xlink-assign-ions ./xlink-score-spectrum]
```

--------------------------------

### Run Comet (2015020) Container

Source: https://github.com/biocontainers/containers/blob/master/MANIFEST.md

Runs the Comet container for version 2015020.

```docker
docker run --rm biodckr/comet
```

--------------------------------

### Run Clustal-Omega Container

Source: https://github.com/biocontainers/containers/blob/master/MANIFEST.md

Runs the Clustal-Omega container for multiple sequence alignment.

```docker
docker run --rm biodckr/clustalo
```

--------------------------------

### Build NCBI BLAST+ Container

Source: https://github.com/biocontainers/containers/blob/master/MANIFEST.md

Builds the NCBI BLAST+ container image. This image is based on the biodckr/biodocker:latest image.

```docker
docker build --rm -t biodckr/ncbi-blast 2.2.28-2/.
```

--------------------------------

### Build InterProScan Docker Container

Source: https://github.com/biocontainers/containers/blob/master/interproscan/5.30-69.0/README.md

Build the InterProScan Docker container locally. Requires Docker 17.05 or higher. This command tags the image as 'interproscan:local'.

```bash
docker build -t interproscan:local .
```

--------------------------------

### Run Comet (2015011) Container

Source: https://github.com/biocontainers/containers/blob/master/MANIFEST.md

Runs the Comet container for version 2015011.

```docker
docker run biodckr/comet
```

--------------------------------

### Pull and Use HMMER Container

Source: https://context7.com/biocontainers/containers/llms.txt

This container is for sequence analysis using profile hidden Markov models. It's useful for building profiles and searching sequence databases.

```bash
# Pull HMMER container
docker pull biocontainers/hmmer:3.2.1dfsg-1-deb
```

```bash
# Build HMM profile from multiple sequence alignment
docker run --rm -v /path/to/data:/data biocontainers/hmmer:3.2.1dfsg-1-deb \
    hmmbuild /data/family.hmm /data/family.sto
```

```bash
# Search protein sequences against HMM profile
docker run --rm -v /path/to/data:/data biocontainers/hmmer:3.2.1dfsg-1-deb \
    hmmsearch --tblout /data/hits.tbl /data/family.hmm /data/proteins.fasta
```

```bash
# Search sequences against Pfam database
docker run --rm -v /path/to/data:/data biocontainers/hmmer:3.2.1dfsg-1-deb \
    hmmscan --domtblout /data/domains.tbl /data/Pfam-A.hmm /data/query.fasta
```

--------------------------------

### Build EMBOSS Container

Source: https://github.com/biocontainers/containers/blob/master/MANIFEST.md

Builds the EMBOSS container image. This image is based on biodckr/biodocker:latest.

```docker
docker build --rm -t biodckr/emboss 6.6.0-1/.
```

--------------------------------

### Build Clustal-Omega Container

Source: https://github.com/biocontainers/containers/blob/master/MANIFEST.md

Builds the Clustal-Omega container image. This image is based on the biodocker:latest image.

```docker
docker build --rm -t biodckr/clustalo 1.2.1-1/.
```

--------------------------------

### Pull and Use VCFtools Container

Source: https://context7.com/biocontainers/containers/llms.txt

Use this container for various VCF file operations, including calculating statistics and subsetting data. Ensure VCF files are gzipped for some operations.

```bash
# Pull vcftools container
docker pull biocontainers/vcftools:0.1.16-1-deb
```

```bash
# Calculate allele frequency statistics
docker run --rm -v /path/to/data:/data biocontainers/vcftools:0.1.16-1-deb \
    vcftools --gzvcf /data/variants.vcf.gz --freq --out /data/allele_freq
```

```bash
# Extract specific samples
docker run --rm -v /path/to/data:/data biocontainers/vcftools:0.1.16-1-deb \
    vcftools --gzvcf /data/variants.vcf.gz \
    --keep /data/sample_list.txt \
    --recode --out /data/subset
```

```bash
# Calculate heterozygosity per individual
docker run --rm -v /path/to/data:/data biocontainers/vcftools:0.1.16-1-deb \
    vcftools --gzvcf /data/variants.vcf.gz --het --out /data/heterozygosity
```

--------------------------------

### Run BioDocker Base Image

Source: https://github.com/biocontainers/containers/blob/master/MANIFEST.md

Runs an interactive bash shell within the BioDocker base container.

```docker
docker run --rm biodckr/biodocker bash
```

--------------------------------

### Reinitialize PyMol

Source: https://github.com/biocontainers/containers/blob/master/pymol-jupiter/1.0.0/ipymol/iPyMol_example.ipynb

Resets PyMol to its default settings. Use this if you encounter issues or need a clean state.

```python
pymol.reinit()
```

--------------------------------

### Pull NCBI BLAST+ Container

Source: https://github.com/biocontainers/containers/blob/master/MANIFEST.md

Pulls the NCBI BLAST+ container image.

```docker
docker pull biodckr/ncbi-blast
```

--------------------------------

### Pull and Use BCFtools Container

Source: https://context7.com/biocontainers/containers/llms.txt

This container is for variant calling and manipulation using VCF/BCF files. It requires a reference genome FASTA file and a sorted BAM file.

```bash
# Pull bcftools container
docker pull biocontainers/bcftools:1.9-1-deb
```

```bash
# Call variants from BAM file
docker run --rm -v /path/to/data:/data biocontainers/bcftools:1.9-1-deb \
    bcftools mpileup -f /data/reference.fa /data/aligned.sorted.bam | \
    bcftools call -mv -Oz -o /data/variants.vcf.gz
```

```bash
# Index VCF file
docker run --rm -v /path/to/data:/data biocontainers/bcftools:1.9-1-deb \
    bcftools index /data/variants.vcf.gz
```

```bash
# Filter variants by quality
docker run --rm -v /path/to/data:/data biocontainers/bcftools:1.9-1-deb \
    bcftools filter -i 'QUAL>30 && DP>10' /data/variants.vcf.gz -o /data/filtered.vcf
```

--------------------------------

### Pull and Use MAFFT Container

Source: https://context7.com/biocontainers/containers/llms.txt

Use this container for fast and accurate multiple sequence alignment. It supports various algorithms for different alignment needs.

```bash
# Pull MAFFT container
docker pull biocontainers/mafft:7.394
```

```bash
# Fast alignment for many sequences (FFT-NS-2)
docker run --rm -v /path/to/data:/data biocontainers/mafft:7.394 \
    mafft --auto /data/sequences.fasta > /data/aligned.fasta
```

```bash
# High accuracy alignment (L-INS-i)
docker run --rm -v /path/to/data:/data biocontainers/mafft:7.394 \
    mafft --localpair --maxiterate 1000 /data/sequences.fasta > /data/aligned_accurate.fasta
```

```bash
# Add sequences to existing alignment
docker run --rm -v /path/to/data:/data biocontainers/mafft:7.394 \
    mafft --add /data/new_seqs.fasta /data/existing_alignment.fasta > /data/extended.fasta
```

--------------------------------

### Pull and Use BEDTools Container

Source: https://context7.com/biocontainers/containers/llms.txt

Use this container to perform operations on genomic interval files. Ensure your data files are mounted into the container's /data directory.

```bash
# Pull bedtools container
docker pull biocontainers/bedtools:2.28.0
```

```bash
# Find intersecting genomic regions
docker run --rm -v /path/to/data:/data biocontainers/bedtools:2.28.0 \
    bedtools intersect -a /data/peaks.bed -b /data/genes.bed > /data/peaks_in_genes.bed
```

```bash
# Compute genome coverage
docker run --rm -v /path/to/data:/data biocontainers/bedtools:2.28.0 \
    bedtools genomecov -ibam /data/aligned.sorted.bam -bg > /data/coverage.bedgraph
```

```bash
# Merge overlapping intervals
docker run --rm -v /path/to/data:/data biocontainers/bedtools:2.28.0 \
    bedtools merge -i /data/peaks.bed > /data/merged_peaks.bed
```

--------------------------------

### Pull EMBOSS Container

Source: https://github.com/biocontainers/containers/blob/master/MANIFEST.md

Pulls the EMBOSS container image.

```docker
docker pull biodckr/emboss
```

--------------------------------

### Build DIA-Umpire Container

Source: https://github.com/biocontainers/containers/blob/master/MANIFEST.md

Builds the DIA-Umpire container image. This image is based on biodocker:latest.

```docker
docker build --rm -t biodckr/diaumpire 1.4256/.
```

--------------------------------

### Build Crux Container

Source: https://github.com/biocontainers/containers/blob/master/MANIFEST.md

Builds the Crux container image. This image is based on biodckr/biodocker:latest.

```docker
docker build --rm -t biodckr/crux 2.1/.
```

--------------------------------

### Base Container Image Structure

Source: https://context7.com/biocontainers/containers/llms.txt

This Dockerfile defines the structure for a base BioContainers image, including common dependencies and pre-configured settings.

```dockerfile
FROM ubuntu:16.04

LABEL software="biocontainers"
LABEL software.version="1.1.0"
LABEL about.summary="Base image for BioDocker"

# Pre-installed: curl, wget, git, build-essential, conda
# Pre-configured: bioconda channel, /data and /config volumes
# Default user: biodocker (uid 1000)

VOLUME ["/data", "/config"]
WORKDIR /data
```

--------------------------------

### Pull BLAST container from Docker Hub

Source: https://context7.com/biocontainers/containers/llms.txt

Pulls the BLAST container image with version 2.6.0 from Docker Hub.

```bash
docker pull biodckr/blast:2.6.0
```

--------------------------------

### Pull DIA-Umpire Container

Source: https://github.com/biocontainers/containers/blob/master/MANIFEST.md

Pulls the DIA-Umpire container image.

```docker
docker pull biodckr/diaumpire
```

--------------------------------

### Build Comet (2015020) Container

Source: https://github.com/biocontainers/containers/blob/master/MANIFEST.md

Builds the Comet container image for version 2015020. This image is based on biodckr/biodocker:latest.

```docker
docker build --rm -t biodckr/comet 2015020/.
```

--------------------------------

### NGS Analysis Pipeline: Cutadapt

Source: https://context7.com/biocontainers/containers/llms.txt

Step 2 of a complete NGS analysis pipeline: Trims adapters from paired-end FASTQ reads using the Cutadapt BioContainer.

```bash
# Step 2: Adapter trimming with Cutadapt
docker run --rm -v ${DATA_DIR}:/data biocontainers/cutadapt:1.18-1-deb-py3 \
    cutadapt -a AGATCGGAAGAG -A AGATCGGAAGAG \
    -o /data/trimmed_R1.fq.gz -p /data/trimmed_R2.fq.gz \
    /data/sample_R1.fastq.gz /data/sample_R2.fastq.gz
```

--------------------------------

### Pull Comet (2015011) Container

Source: https://github.com/biocontainers/containers/blob/master/MANIFEST.md

Pulls the Comet container image for version 2015011.

```docker
docker pull biodckr/comet
```

--------------------------------

### Build Comet (2015011) Container

Source: https://github.com/biocontainers/containers/blob/master/MANIFEST.md

Builds the Comet container image for version 2015011. This image is based on biodckr/biodocker:latest.

```docker
docker build -t biodckr/comet 2015011/.
```

--------------------------------

### Pull Cutadapt Container

Source: https://context7.com/biocontainers/containers/llms.txt

Pulls the latest Python 3 version of the Cutadapt BioContainer.

```bash
docker pull biocontainers/cutadapt:1.18-1-deb-py3
```

--------------------------------

### Pull Clustal-Omega Container

Source: https://github.com/biocontainers/containers/blob/master/MANIFEST.md

Pulls the Clustal-Omega container image.

```docker
docker pull biodckr/clustalo
```

--------------------------------

### Build Comet (2015012) Container

Source: https://github.com/biocontainers/containers/blob/master/MANIFEST.md

Builds the Comet container image for version 2015012. This image is based on biodckr/biodocker:latest.

```docker
docker build -t biodckr/comet 2015012/.
```

--------------------------------

### Pull BioDocker Base Image

Source: https://github.com/biocontainers/containers/blob/master/MANIFEST.md

Pulls the latest BioDocker base image from the registry.

```docker
docker pull biodckr/biodocker
```

--------------------------------

### Pull Salmon container from Quay.io

Source: https://context7.com/biocontainers/containers/llms.txt

Pulls the Salmon container image with version 1.4.0 from Quay.io, often auto-generated from Bioconda packages.

```bash
docker pull quay.io/biocontainers/salmon:1.4.0--hf69c8f4_0
```

--------------------------------

### Pull Crux Container

Source: https://github.com/biocontainers/containers/blob/master/MANIFEST.md

Pulls the Crux container image.

```docker
docker pull biodckr/crux
```

--------------------------------

### Pull BWA container from Docker Hub

Source: https://context7.com/biocontainers/containers/llms.txt

Pulls the BWA container image with version 0.7.17 from Docker Hub, the primary registry for BioContainers.

```bash
docker pull biocontainers/bwa:0.7.17
```

--------------------------------

### NGS Analysis Pipeline: FastQC

Source: https://context7.com/biocontainers/containers/llms.txt

Step 1 of a complete NGS analysis pipeline: Performs quality control on FASTQ files using the FastQC BioContainer.

```bash
# Step 1: Quality control with FastQC
docker run --rm -v ${DATA_DIR}:/data biocontainers/fastqc:0.11.9 \
    fastqc /data/sample_R1.fastq.gz /data/sample_R2.fastq.gz -o /data/qc/
```

--------------------------------

### NGS Analysis Pipeline: BWA Index

Source: https://context7.com/biocontainers/containers/llms.txt

Step 3 of a complete NGS analysis pipeline: Indexes a reference genome for alignment using the BWA BioContainer. This is typically a one-time operation per reference.

```bash
# Step 3: Index reference (one-time)
docker run --rm -v ${DATA_DIR}:/data biocontainers/bwa:0.7.17 \
    bwa index /data/reference.fa
```

=== COMPLETE CONTENT === This response contains all available snippets from this library. No additional content exists. Do not make further requests.