### Install HUMAnN from Source

Source: https://github.com/biobakery/humann/blob/master/readme.md

Installs HUMAnN by building from its source code. Navigate to the HUMAnN directory and run the setup script. Use '--user' if write permissions are limited.

```bash
$ cd $HUMAnN_PATH
$ python setup.py install
```

--------------------------------

### Install HUMAnN with pip

Source: https://github.com/biobakery/humann/blob/master/readme.md

Installs HUMAnN and its core dependencies (MinPath, glpk, Bowtie2, Diamond) using pip. Use '--user' if write permissions are limited.

```bash
$ pip install humann
```

--------------------------------

### Custom Pathways Database - Structured Format Example

Source: https://github.com/biobakery/humann/blob/master/readme.md

Example of a structured pathways file where the first column is the pathway name and the second column describes pathway components using specific syntax (e.g., alternatives, complexes).

```text
PWY-1	A B ( C , D )
PWY-2	( ( A + B ) , ( C + D ) ) E
```

--------------------------------

### Test HUMAnN Installation

Source: https://github.com/biobakery/humann/blob/master/readme.md

Runs unit and functional tests to verify the HUMAnN installation. Additional options can enable tool or end-to-end tests.

```bash
$ humann_test
```

--------------------------------

### Run HUMAnN Demo

Source: https://github.com/biobakery/humann/blob/master/readme.md

Executes a demo run of HUMAnN using sample data. This requires the HUMAnN software to be installed and the demo data to be downloaded.

```bash
$ humann --input examples/demo.fastq --output $OUTPUT_DIR
```

--------------------------------

### Pathway Abundance File Structure

Source: https://github.com/biobakery/humann/blob/master/readme.md

This is an example of the pathway abundance file format. It lists pathways and their corresponding abundance values in the community.

```text
# Pathway	$SAMPLENAME_Abundance
UNMAPPED	140.0
UNINTEGRATED	87.0
UNINTEGRATED|g__Bacteroides.s__Bacteroides_caccae	23.0
UNINTEGRATED|g__Bacteroides.s__Bacteroides_finegoldii	20.0
UNINTEGRATED|unclassified	12.0
PWY0-1301: melibiose degradation	57.5
PWY0-1301: melibiose degradation|g__Bacteroides.s__Bacteroides_caccae	32.5
PWY0-1301: melibiose degradation|g__Bacteroides.s__Bacteroides_finegoldii	4.5
PWY0-1301: melibiose degradation|unclassified	3.0
PWY-5484: glycolysis II (from fructose-6P)	54.7
PWY-5484: glycolysis II (from fructose-6P)|g__Bacteroides.s__Bacteroides_caccae	16.7
PWY-5484: glycolysis II (from fructose-6P)|g__Bacteroides.s__Bacteroides_finegoldii	8.0
PWY-5484: glycolysis II (from fructose-6P)|unclassified	6.0
```

--------------------------------

### Custom Reference Database Annotations Example

Source: https://github.com/biobakery/humann/blob/master/readme.md

Example of a tab-delimited file mapping identifiers to gene family, gene length, and taxonomy for custom reference databases.

```text
256402719	UniRef50_C9LQU5	147	g__Dialister.s__Dialister_invisus
479150083	UniRef50_R6U703	540	g__Ruminococcus.s__Ruminococcus_bromii
423220654	UniRef50_I8UUJ6	1218	g__Bacteroides.s__Bacteroides_caccae
```

--------------------------------

### Example HUMAnN Log File Configuration Settings

Source: https://github.com/biobakery/humann/blob/master/readme.md

This section shows how configuration settings are logged at the beginning of each HUMAnN run. It includes details on database locations, run modes, alignment parameters, pathway settings, and input/output formats.

```sh
03/16/2015 01:09:52 PM - humann.config - INFO: 
Run config settings: 

DATABASE SETTINGS
nucleotide database folder = data/chocophlan_DEMO
protein database folder = data/uniref_DEMO
pathways database file 1 = data/pathways/metacyc_reactions.uniref
pathways database file 2 = data/pathways/metacyc_pathways

RUN MODES
resume = False
verbose = True
bypass prescreen = False
bypass nucleotide index = False
bypass nucleotide search = False
bypass translated search = False
translated search = diamond
pick frames = off
threads = 4

ALIGNMENT SETTINGS
evalue threshold = 1.0
prescreen threshold = 0.5
identity threshold = 50.0

PATHWAYS SETTINGS
minpath = on
xipe = off

INPUT AND OUTPUT FORMATS
input file format = fastq
output file format = tsv
output max decimals = 10
remove stratified output = False
log level = DEBUG
```

--------------------------------

### Custom Pathways Database - Unstructured Format Example

Source: https://github.com/biobakery/humann/blob/master/readme.md

Example of an unstructured pathways file where the first column is the pathway name and subsequent columns list individual genes belonging to the pathway.

```text
PWY-3	A	B	C	D
PWY-4	A	B	C	D	E
```

--------------------------------

### Download ChocoPhlAn Database

Source: https://github.com/biobakery/humann/blob/master/readme.md

Use this command to download the ChocoPhlAn database. The installation location will be updated in the humann config file.

```bash
$ humann_databases --download chocophlan full $INSTALL_LOCATION
```

--------------------------------

### Clone HUMAnN Repository

Source: https://github.com/biobakery/humann/blob/master/readme.md

Use this command to download the development version of HUMAnN from GitHub. Requires Git to be installed.

```bash
$ git clone https://github.com/biobakery/humann
```

--------------------------------

### Download a HUMAnN Database

Source: https://github.com/biobakery/humann/blob/master/readme.md

This command downloads a specified database build to a given installation location. It automatically updates the HUMAnN configuration. If configuration file editing is not permitted, use the `--update-config no` option.

```sh
$ humann_databases --download $DATABASE $BUILD $INSTALL_LOCATION
```

--------------------------------

### Custom Taxonomic Profile Example

Source: https://github.com/biobakery/humann/blob/master/readme.md

This tab-delimited file specifies taxa and their percent abundance for creating a custom ChocoPhlAn database. Ensure taxa naming conventions match the full ChocoPhlAn database.

```text
g__Bacteroides|s__Bacteroides_thetaiotaomicron	12.16326
g__Bacteroides|s__Bacteroides_cellulosilyticus	12.02768
g__Bacteroides|s__Bacteroides_caccae	11.43394
g__Dialister|s__Dialister_invisus	10.52286
g__Bacteroides|s__Bacteroides_stercoris	10.42227
```

--------------------------------

### Download Full UniRef50 Translated Search Database

Source: https://github.com/biobakery/humann/blob/master/readme.md

Downloads the full UniRef50 translated search database. The installation location will be updated in the humann config file.

```bash
$ humann_databases --download uniref uniref50_diamond $INSTALL_LOCATION
```

--------------------------------

### Custom Pathways Database - Gene Family to Reaction Mapping

Source: https://github.com/biobakery/humann/blob/master/readme.md

Example of a comma-delimited file mapping gene families to reactions for a custom pathways database. The first column is the reaction, and subsequent columns are gene families.

```text
RXN-123	UniRef50_A0B6Z6	UniRef50_A3CRP6
RXN-456	UniRef50_A2RVM0	UniRef50_A4IGM4	UniRef50_A6NKP2	UniRef50_B8H806
```

--------------------------------

### Download Full UniRef90 Translated Search Database

Source: https://github.com/biobakery/humann/blob/master/readme.md

Downloads the recommended full UniRef90 translated search database. The installation location will be updated in the humann config file.

```bash
$ humann_databases --download uniref uniref90_diamond $INSTALL_LOCATION
```

--------------------------------

### Bowtie2 Alignment Results (SAM Format)

Source: https://github.com/biobakery/humann/blob/master/readme.md

This file contains the full alignment output from Bowtie2 in SAM format. It includes headers starting with '@' and alignment records for each read.

```sam
@HD	VN:1.0	SO:unsorted
@SQ	SN:g__Ruminococcus.s__Ruminococcus_bromii|UniRef90_D4L6K4|UniRef50_R6U703	LN:540
r99491	0	g__Bacteroides.s__Bacteroides_stercoris|UniRef90_R6B629|UniRef50_R5RCC8	1015	42	151M	*	0	0	CTGACCGATTTATATGAGGA	zzzzzzzzzzzzzzzzzzzz
r99526	0	g__Parabacteroides.s__Parabacteroides_merdae|UniRef90_unknown|UniRef50_D9RX34	155	42	151M	*	0	0	AATTTTCTTCAAAAAATATA	zzzzzzzzzzzzzzzzzzzz
r99581	16	g__Bacteroides.s__Bacteroides_stercoris|UniRef90_unknown|UniRef50_R6SXR7	2503	42	151M	*	0	0	TCTTTTATGCAGGGGATATG	zzzzzzzzzzzzzzzzzzzz
```

--------------------------------

### Download EC-Filtered UniRef50 Translated Search Database

Source: https://github.com/biobakery/humann/blob/master/readme.md

Downloads the EC-filtered UniRef50 translated search database, which is very small in size. The installation location will be updated in the humann config file.

```bash
$ humann_databases --download uniref uniref50_ec_filtered_diamond $INSTALL_LOCATION
```

--------------------------------

### Download EC-Filtered UniRef90 Translated Search Database

Source: https://github.com/biobakery/humann/blob/master/readme.md

Downloads the EC-filtered UniRef90 translated search database, which is smaller in size. The installation location will be updated in the humann config file.

```bash
$ humann_databases --download uniref uniref90_ec_filtered_diamond $INSTALL_LOCATION
```

--------------------------------

### List Available HUMAnN Databases

Source: https://github.com/biobakery/humann/blob/master/readme.md

Use this command to view all available database builds and their download locations. The output shows the database name, build type (e.g., DEMO, full, diamond), and the URL for downloading.

```sh
$ humann_databases --available
HUMANnN Databases ( database : build = location )
chocophlan : DEMO = http://huttenhower.sph.harvard.edu/humann_data/chocophlan/DEMO_chocophlan.tar.gz
chocophlan : full = http://huttenhower.sph.harvard.edu/humann_data/chocophlan/full_chocophlan.tar.gz
uniref : DEMO_diamond = http://huttenhower.sph.harvard.edu/humann_data/uniprot/uniref50_GO_filtered/uniref50_DEMO_diamond.tar.gz
uniref : diamond = http://huttenhower.sph.harvard.edu/humann_data/uniprot/uniref50_GO_filtered/uniref50_GO_filtered_diamond.tar.gz
```

--------------------------------

### HUMAnN Usage and Options

Source: https://github.com/biobakery/humann/blob/master/readme.md

Displays the general usage syntax and lists all available command-line options for the HUMAnN tool. This is useful for understanding the basic structure of a HUMAnN command.

```bash
usage: humann [-h] -i <input.fastq> -o <output> [--threads <1>] [--version]
              [-r] [--bypass-nucleotide-index] [--bypass-nucleotide-search]
              [--bypass-prescreen] [--bypass-translated-search]
              [--taxonomic-profile <taxonomic_profile.tsv>]
              [--memory-use {minimum,maximum}]
              [--input-format {fastq,fastq.gz,fasta,fasta.gz,sam,bam,blastm8,genetable,biom}]
              [--metaphlan <metaphlan>]
              [--metaphlan-options <metaphlan_options>]
              [--prescreen-threshold <0.5>]
              [--bowtie2 <bowtie2>]
              [--bowtie-options <bowtie_options>]
              [--nucleotide-database <nucleotide_database>]
              [--nucleotide-identity-threshold <0.0>]
              [--nucleotide-query-coverage-threshold <90.0>]
              [--nucleotide-subject-coverage-threshold <50.0>]
              [--diamond <diamond>]
              [--diamond-options <diamond_options>]
              [--evalue <1.0>]
              [--pick-frames {on,off}]
              [--protein-database <protein_database>]
              [--translated-alignment {diamond}]
              [--translated-identity-threshold <50.0>]
              [--translated-query-coverage-threshold <90.0>]
              [--translated-subject-coverage-threshold <50.0>]
              [--gap-fill {on,off}]
              [--minpath {on,off}]
              [--pathways {metacyc,unipathway}]
              [--pathways-database <pathways_database.tsv>]
              [--xipe {on,off}]
              [--annotation-gene-index <3>]
              [--id-mapping <id_mapping.tsv>]
              [--remove-temp-output]
              [--log-level {DEBUG,INFO,WARNING,ERROR,CRITICAL}]
              [--o-log <sample_0.log>]
              [--output-basename <sample_name>]
              [--output-format {tsv,biom}]
              [--output-max-decimals <10>]
              [--remove-column-description-output]
              [--remove-stratified-output]

HUMAnN : HMP Unified Metabolic Analysis Network 

optional arguments:
  -h, --help            show this help message and exit
```

--------------------------------

### Run HUMAnN with FASTA Demo

Source: https://github.com/biobakery/humann/blob/master/readme.md

Execute HUMAnN using a demo FASTA file. Replace `$OUTPUT_DIR` with your desired output directory.

```bash
$ humann --input examples/demo.fasta --output $OUTPUT_DIR
```

--------------------------------

### Run HUMAnN with SAM Demo

Source: https://github.com/biobakery/humann/blob/master/readme.md

Execute HUMAnN using a demo SAM file. Replace `$OUTPUT_DIR` with your desired output directory. Using SAM files bypasses nucleotide and translated mapping steps.

```bash
$ humann --input examples/demo.sam --output $OUTPUT_DIR
```

--------------------------------

### Basic HUMAnN Command

Source: https://github.com/biobakery/humann/blob/master/readme.md

This is the fundamental command to run HUMAnN. Ensure you replace `$SAMPLE` with your input file path and `$OUTPUT_DIR` with your desired output directory.

```bash
$ humann --input $SAMPLE --output $OUTPUT_DIR
```

--------------------------------

### Example of Paired-End Read Alignment

Source: https://github.com/biobakery/humann/blob/master/readme.md

Illustrates a scenario where one read (READ1) maps to a coding sequence while its mate-pair (READ2) does not. HUMAnN treats reads independently due to the lack of genomic context.

```text
GENEGENEGENE
     READ1-------READ2
```

--------------------------------

### Run HUMAnN with Custom Database

Source: https://github.com/biobakery/humann/blob/master/readme.md

Processes remaining samples using a pre-generated custom indexed ChocoPhlAn database, bypassing the need to re-index for each sample.

```bash
$ humann --input $SAMPLE.fastq --output $OUTPUT_DIR --nucleotide-database $OUTPUT_DIR/$SAMPLE_1_humann_temp/ --bypass-nucleotide-index
```

--------------------------------

### Run HUMAnN on a single FASTQ file

Source: https://github.com/biobakery/humann/blob/master/readme.md

Execute HUMAnN on a filtered shotgun sequencing metagenome file. Replace `$SAMPLE.fastq` with your input file name and `$OUTPUT_DIR` with the desired output directory.

```bash
humann --input $SAMPLE.fastq --output $OUTPUT_DIR
```

--------------------------------

### Normalize Gene Family Abundance Table

Source: https://github.com/biobakery/humann/blob/master/readme.md

Normalize gene family abundance data using `humann_renorm_table`. This example normalizes to relative abundance (`relab`). Replace `$SAMPLE_2_genefamilies.tsv` with your input file and `$SAMPLE_2_genefamilies_relab.tsv` with the desired output file name.

```bash
humann_renorm_table --input $SAMPLE_2_genefamilies.tsv --output $SAMPLE_2_genefamilies_relab.tsv --units relab
```

--------------------------------

### Print Current HUMAnN Configuration

Source: https://github.com/biobakery/humann/blob/master/readme.md

Displays the current settings stored in the HUMAnN configuration file. The output is organized by section and shows the name and value of each configuration parameter.

```sh
$ humann_config --print
HUMAnN Configuration ( Section : Name = Value )
output_format : remove_stratified_output = False
output_format : output_max_decimals = 10
alignment_settings : prescreen_threshold = 0.5
alignment_settings : evalue_threshold = 1.0
alignment_settings : identity_threshold = 50.0
database_folders : nucleotide = data/chocophlan_DEMO
database_folders : protein = data/uniref_DEMO
run_modes : bypass_nucleotide_search = False
run_modes : verbose = False
run_modes : bypass_nucleotide_index = False
run_modes : bypass_translated_search = False
run_modes : resume = False
run_modes : threads = 1
run_modes : bypass_prescreen = False
```

--------------------------------

### Run HUMAnN with BLASTm8 Demo

Source: https://github.com/biobakery/humann/blob/master/readme.md

Execute HUMAnN using a demo BLASTm8 file. Replace `$OUTPUT_DIR` with your desired output directory. Using BLASTm8 files bypasses nucleotide and translated mapping steps.

```bash
$ humann --input examples/demo.m8 --output $OUTPUT_DIR
```

--------------------------------

### Run HUMAnN for Sample Processing

Source: https://github.com/biobakery/humann/blob/master/readme.md

Execute HUMAnN on individual FASTQ samples to generate gene family and pathway abundance data in biom format. Ensure output files are configured with specified decimals.

```bash
$ humann --input $SAMPLE.fastq --output $OUTPUT_DIR --output-format biom --remove-stratified-output --output-max-decimals 0
```

--------------------------------

### Basic humann_join_tables Usage

Source: https://github.com/biobakery/humann/blob/master/readme.md

Joins multiple single-sample output files into a single table with multiple samples. Input can be TSV or BIOM format.

```bash
humann_join_tables --input $INPUT_DIR --output $TABLE
```

--------------------------------

### HUMAnN Workflow Refinement Options

Source: https://github.com/biobakery/humann/blob/master/readme.md

Allows for fine-tuning the HUMAnN workflow by enabling or bypassing specific steps. Use these options to resume interrupted analyses or skip computationally intensive stages.

```bash
-r, --resume                        bypass commands if the output files exist
```

```bash
--bypass-nucleotide-index                        bypass the nucleotide index step and run on the indexed ChocoPhlAn database
```

```bash
--bypass-nucleotide-search                        bypass the nucleotide search steps
```

```bash
--bypass-prescreen                        bypass the prescreen step and run on the full ChocoPhlAn database
```

```bash
--bypass-translated-search                        bypass the translated search step
```

```bash
--taxonomic-profile <taxonomic_profile.tsv>                        a taxonomic profile (the output file created by metaphlan)
                        [DEFAULT: file will be created]
```

```bash
--memory-use {minimum,maximum}                        the amount of memory to use
                        [DEFAULT: minimum]
```

```bash
--input-format {fastq,fastq.gz,fasta,fasta.gz,sam,bam,blastm8,genetable,biom}                        the format of the input file
                        [DEFAULT: format identified by software]
```

```bash
-v, --verbose                        additional output is printed
```

--------------------------------

### HUMAnN Common Settings

Source: https://github.com/biobakery/humann/blob/master/readme.md

Configures essential parameters for HUMAnN, including input and output file locations, and the number of threads for processing. These are fundamental settings for any HUMAnN run.

```bash
-i <input.fastq>, --input <input.fastq>                        input file of type {fastq,fastq.gz,fasta,fasta.gz,sam,bam,blastm8,genetable,biom} 
                        [REQUIRED]
```

```bash
-o <output>, --output <output>                        directory to write output files
                        [REQUIRED]
```

```bash
--threads <1>                        number of threads/processes
                        [DEFAULT: 1]
```

```bash
--version                        show program's version number and exit
```

--------------------------------

### Merge HUMAnN Output Files with QIIME

Source: https://github.com/biobakery/humann/blob/master/readme.md

Combine individual sample biom files (gene families and pathway abundance) into single tables for all samples using QIIME's merge_otu_tables.py script. This prepares the data for downstream diversity analysis.

```bash
$ merge_otu_tables.py -i $SAMPLE1_2_genefamilies.biom,$SAMPLE2_2_genefamilies.biom,$SAMPLE3_2_genefamilies.biom -o genefamilies_all.biom
```

```bash
$ merge_otu_tables.py -i $SAMPLE1_4_pathabundance.biom,$SAMPLE2_4_pathabundance.biom,$SAMPLE3_4_pathabundance.biom -o pathabundance_all.biom
```

--------------------------------

### Create Custom ChocoPhlAn Database

Source: https://github.com/biobakery/humann/blob/master/readme.md

Generates a custom indexed ChocoPhlAn database by running HUMAnN on a single sample with a taxonomic profile. This database can then be reused for other samples to save computation time.

```bash
$ humann --input $SAMPLE_1.fastq --output $OUTPUT_DIR --taxonomic-profile max_taxonomic_profile.tsv
```

--------------------------------

### Run HUMAnN with Taxonomic Profile

Source: https://github.com/biobakery/humann/blob/master/readme.md

Executes HUMAnN using a pre-generated maximum taxonomic profile for each sample. This method can be optimized by creating a custom ChocoPhlAn database once.

```bash
$ humann --input $SAMPLE.fastq --output $OUTPUT_DIR --taxonomic-profile max_taxonomic_profile.tsv
```

--------------------------------

### Join Normalized Pathway Abundance Tables

Source: https://github.com/biobakery/humann/blob/master/readme.md

Merge normalized pathway abundance tables from multiple samples into a single file. Replace `$OUTPUT_DIR` with the path to the directory containing the HUMAnN output files.

```bash
humann_join_tables --input $OUTPUT_DIR --output humann_4_pathabundance.tsv --file_name pathabundance_relab
```

--------------------------------

### Run HUMAnN with PICRUSt Output

Source: https://github.com/biobakery/humann/blob/master/readme.md

Executes HUMAnN on individual sample files generated from PICRUSt output. Supports both KEGG pathways and modules. Output can be set to biom format.

```bash
$ humann --input $SAMPLE.biom --output $OUTPUT_DIR2 --pathways-database humann1/data/keggc
```

--------------------------------

### Join Taxonomic Profiles

Source: https://github.com/biobakery/humann/blob/master/readme.md

Merges taxonomic profiles from multiple samples into a single table for comprehensive analysis.

```bash
$ humann_join_tables --input $DIR --output joined_taxonomic_profile.tsv
```

--------------------------------

### Run QIIME Core Diversity Analyses

Source: https://github.com/biobakery/humann/blob/master/readme.md

Perform core diversity analyses on the merged BIOM files using QIIME's core_diversity_analyses.py script. Provide the sampling depth (e-value) and a QIIME mapping file as input. This generates various diversity metrics and PCoA plots.

```bash
$ core_diversity_analyses.py -i genefamilies_all.biom -o core_diversity_genefamilies -m $MAPPING_FILE --nonphylogenetic_diversity -e $EVALUE --suppress_taxa_summary
```

```bash
$ core_diversity_analyses.py -i pathabundance_all.biom -o core_diversity_pathabundance -m $MAPPING_FILE --nonphylogenetic_diversity -e $EVALUE --suppress_taxa_summary
```

--------------------------------

### Bowtie2 Reduced Alignment Results (Blast m8 Format)

Source: https://github.com/biobakery/humann/blob/master/readme.md

This file contains a minimal set of alignment results from the Bowtie2 SAM file, formatted similarly to blast m8. Some columns are always empty to reduce file size.

```blast-m8
r93	gi|423245752|ref|NZ_JH724135.1|:381614-382081|357276|g__Bacteroides.s__Bacteroides_dorei|UniRef90_A6L5K0|UniRef50_A6L5K0|468	99.0	100.0					0
r113	gi|423245752|ref|NZ_JH724135.1|:381614-382081|357276|g__Bacteroides.s__Bacteroides_dorei|UniRef90_A6L5K0|UniRef50_A6L5K0|468	99.0	100.0					0
r704	gi|423245752|ref|NZ_JH724135.1|:381614-382081|357276|g__Bacteroides.s__Bacteroides_dorei|UniRef90_A6L5K0|UniRef50_A6L5K0|468	99.0	100.0					0
r663	gi|423245752|ref|NZ_JH724135.1|:381614-382081|357276|g__Bacteroides.s__Bacteroides_dorei|UniRef90_A6L5K0|UniRef50_A6L5K0|468	99.0	100.0					0
r940	gi|423245752|ref|NZ_JH724135.1|:381614-382081|357276|g__Bacteroides.s__Bacteroides_dorei|UniRef90_A6L5K0|UniRef50_A6L5K0|468	99.0	100.0					0
```

--------------------------------

### MetaPhlAn Bowtie2 Output

Source: https://github.com/biobakery/humann/blob/master/readme.md

Tab-separated file containing Bowtie2 alignment results from MetaPhlAn. It maps reads to reference sequences.

```text
r113	gi|224485636|ref|NZ_EQ973490.1|:c728571-728107
r559	gi|479185170|ref|NC_021030.1|:c1678719-1677127
r663	gi|512436175|ref|NZ_KE159463.1|:c142391-139122
r704	gi|423310881|ref|NZ_JH724270.1|:c220428-218656
r1086	gi|238922432|ref|NC_012781.1|:c1988048-1987140
```

--------------------------------

### Compute Genus-Level Pathways with HUMAnN

Source: https://github.com/biobakery/humann/blob/master/readme.md

Run HUMAnN using the previously generated genus-level gene families file to obtain genus-level pathway outputs. This process is faster and less memory-intensive than a full HUMAnN run.

```bash
humann --input $SAMPLE_genefamilies_genus_level.tsv --output humann_genus_level_output
```

--------------------------------

### Reactions Abundance Data

Source: https://github.com/biobakery/humann/blob/master/readme.md

This snippet illustrates the format of the reactions output file. It shows the abundance of each reaction in the community, including unmapped reads and species-specific contributions.

```text
# Reaction	$SAMPLENAME_Abundance
READS_UNMAPPED	7573721.0000000000
UNGROUPED	22978726.4009404778
UNGROUPED|g__Bacteroides.s__Bacteroides_vulgatus	1961355.5951347812
UNGROUPED|g__Bacteroides.s__Bacteroides_uniformis	1579305.9455720731
UNGROUPED|unclassified	5100980.1244789278
2.7.13.3-RXN	75608.6164459985
2.7.13.3-RXN|g__Bacteroides.s__Bacteroides_uniformis	7962.2303221576
2.7.13.3-RXN|g__Faecalibacterium.s__Faecalibacterium_prausnitzii	5371.8462336209
2.7.13.3-RXN|unclassified	12529.4324849206
```

--------------------------------

### Update UniRef Database Location

Source: https://github.com/biobakery/humann/blob/master/readme.md

Use this command to update the configuration file to point to the UniRef database directory. Replace $DIR with the actual path.

```bash
humann_config --update database_folders protein $DIR
```

--------------------------------

### Split PICRUSt Table

Source: https://github.com/biobakery/humann/blob/master/readme.md

Splits a PICRUSt output file (biom or tsv) into individual files per sample. Use --taxonomy_index -1 if taxonomy is included in the biom file.

```bash
$ humann_split_table --input picrust.biom --output $OUTPUT_DIR
```

--------------------------------

### HUMAnN Prescreen Configuration

Source: https://github.com/biobakery/humann/blob/master/readme.md

Configures the prescreening step in HUMAnN, which involves setting thresholds for genome coverage and specifying paths to external tools like MetaPhlAn. This step helps in filtering genomes before detailed analysis.

```bash
--metaphlan <metaphlan>                        directory containing the MetaPhlAn software
                        [DEFAULT: $PATH]
```

```bash
--metaphlan-options <metaphlan_options>                        options to be provided to the MetaPhlAn software
                        [DEFAULT: "-t rel_ab"]
```

```bash
--prescreen-threshold <0.5>                        minimum estimated genome coverage for inclusion in pangenome search
                        [DEFAULT: 0.5]
```

--------------------------------

### Custom ChocoPhlAn Database (FASTA)

Source: https://github.com/biobakery/humann/blob/master/readme.md

FASTA file representing a custom ChocoPhlAn database, containing sequences for alignment.

```fasta
>gi|479150083|ref|NC_021013.1|:976220-976759|40518|g__Ruminococcus.s__Ruminococcus_bromii|UniRef90_D4L6K4|UniRef50_R6U703
ATGTTCTATGTATTTCTTGCAGAAGGCTTTGAAGAAACAGAGGCGCTTGCCCCCGTTGATGTAATGCGCAGGGCAAAGCT
TGATGTTAAAACAGTCGGTGTAACAGGCGAATGTGTTACAAGCTCACACGGTGTGCCTGTAAAAGCCGATATCACAATTG
GACAATATTGACCTTGACGATGTTCAGGGTGTTGTACTCCCCGGTGGTATGCCCGGAACTCTCAATCTTGAGGCAAACAAA
AAGGTTCTTGAGGCTGTTAAGTATAGCTGTGAAAACGGCAAAATCGTTGCCGCAATCTGTGCCGCTCCGTCAATTCTCGG
```

--------------------------------

### Split HUMAnN Table by Sample

Source: https://github.com/biobakery/humann/blob/master/readme.md

Splits a merged gene/pathway table into individual files, one per sample. Necessary for analyses that process samples one at a time. Supports TSV or BIOM input formats.

```bash
$ humann_split_table --input $TABLE --output $OUTPUT_DIR
```

--------------------------------

### Download Utility Mapping Files

Source: https://github.com/biobakery/humann/blob/master/readme.md

Download mapping files for regrouping gene families into different functional categories. These files are stored in the specified directory and registered for use with humann_regroup_table.

```bash
$ humann_databases --download utility_mapping full $DIR
```

--------------------------------

### Join HUMAnN Pathways Data

Source: https://github.com/biobakery/humann/blob/master/readme.md

Combines pathway abundance data files from multiple HUMAnN runs into a single table. Handles both tsv and biom formats.

```bash
$ humann_join_tables --input $OUTPUT_DIR2 --output humann_4_pathabundance.tsv --file_name pathabundance
```

--------------------------------

### Summarize BIOM Tables with QIIME

Source: https://github.com/biobakery/humann/blob/master/readme.md

Use QIIME's biom summarize-table command to generate summary statistics for merged BIOM files. This step is crucial for determining the sampling depth (e-value) required for core diversity analyses.

```bash
$ biom summarize-table -i genefamilies_all.biom -o genefamilies_summary.txt
```

```bash
$ biom summarize-table -i pathabundance_all.biom -o pathabundance_summary.txt
```

--------------------------------

### Update ChocoPhlAn Database Location

Source: https://github.com/biobakery/humann/blob/master/readme.md

Use this command to update the configuration file to point to the ChocoPhlAn database directory. Replace $DIR with the actual path.

```bash
humann_config --update database_folders nucleotide $DIR
```

--------------------------------

### Create a Custom Mapping File for Regrouping

Source: https://github.com/biobakery/humann/blob/master/readme.md

Users can create their own mapping files to regroup gene families. The format requires a group name followed by a list of UniRef IDs, separated by tabs. The 'UNMAPPED' feature is carried forward, and unassigned genes form an 'UNGROUPED' group.

```plaintext
group1	uniref1	uniref2	uniref3	...
group2	uniref1	uniref5	...
```

--------------------------------

### Join Normalized Gene Family Tables

Source: https://github.com/biobakery/humann/blob/master/readme.md

Merge normalized gene family abundance tables from multiple samples into a single file. Replace `$OUTPUT_DIR` with the path to the directory containing the HUMAnN output files.

```bash
humann_join_tables --input $OUTPUT_DIR --output humann_2_genefamilies.tsv --file_name genefamilies_relab
```