### Install virtual environment (with Flash Attention)

Source: https://github.com/automl/rnaformer/blob/main/README.md

Installs the Python virtual environment, dependencies, Flash Attention, and the RNAformer package. Requires a compatible GPU.

```bash
python3 -m venv venv

source venv/bin/activate

pip install -r requirements.txt
pip install flash-attn==2.3.4
pip install -e .
```

--------------------------------

### Install virtual environment (without Flash Attention/GPU)

Source: https://github.com/automl/rnaformer/blob/main/README.md

Installs the Python virtual environment, dependencies, and the RNAformer package for inference and evaluation without GPU support.

```bash
python3 -m venv venv

source venv/bin/activate

pip install -r requirements.txt
pip install -e .
```

--------------------------------

### Infer RNAformer for RNA sequence

Source: https://github.com/automl/rnaformer/blob/main/README.md

Example script for performing inference with RNAformer on a given RNA sequence. Outputs predicted paired positions.

```bash
python infer_RNAformer.py -c 6 -s GCCCGCAUGGUGAAAUCGGUAAACACAUCGCACUAAUGCGCCGCCUCUGGCUUGCCGGUUCAAGUCCGGCUGCGGGCACCA --state_dict models/RNAformer_32M_state_dict_intra_family_finetuned.pth --config models/RNAformer_32M_config_intra_family_finetuned.yml
```

--------------------------------

### Download pretrained models

Source: https://github.com/automl/rnaformer/blob/main/README.md

Downloads all pretrained model checkpoints.

```bash
bash download_all_models.sh
```

--------------------------------

### Download datasets

Source: https://github.com/automl/rnaformer/blob/main/README.md

Downloads all necessary datasets for RNAformer.

```bash
bash download_all_datasets.sh
```

--------------------------------

### Clone the repository

Source: https://github.com/automl/rnaformer/blob/main/README.md

Clones the RNAformer repository and navigates into the directory.

```bash
git clone https://github.com/automl/RNAformer.git
cd RNAformer
```

--------------------------------

### Reproduce results from the paper

Source: https://github.com/automl/rnaformer/blob/main/README.md

Runs the evaluation script to reproduce results from the paper.

```bash
bash run_evaluation.sh
```

=== COMPLETE CONTENT === This response contains all available snippets from this library. No additional content exists. Do not make further requests.